ID: 1029507554

View in Genome Browser
Species Human (GRCh38)
Location 7:100971479-100971501
Sequence GTTCCACCATCCTCCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029507547_1029507554 12 Left 1029507547 7:100971444-100971466 CCTGCAGGACACCTTCGAGGTAA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1029507554 7:100971479-100971501 GTTCCACCATCCTCCCAGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 296
1029507546_1029507554 13 Left 1029507546 7:100971443-100971465 CCCTGCAGGACACCTTCGAGGTA 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1029507554 7:100971479-100971501 GTTCCACCATCCTCCCAGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 296
1029507550_1029507554 1 Left 1029507550 7:100971455-100971477 CCTTCGAGGTAACCCACCAGGGA 0: 1
1: 0
2: 0
3: 9
4: 60
Right 1029507554 7:100971479-100971501 GTTCCACCATCCTCCCAGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029507554 Original CRISPR GTTCCACCATCCTCCCAGCC AGG Intronic
900190941 1:1351938-1351960 GATGCACCCCCCTCCCAGCCCGG - Intergenic
900801032 1:4737211-4737233 GCCCCAGCCTCCTCCCAGCCTGG - Intronic
901083643 1:6597647-6597669 GCCCCACCATCCCCCCAGACAGG - Intronic
901489564 1:9589643-9589665 GGGCCACCCTCCTCCCTGCCCGG + Intronic
901685009 1:10938931-10938953 GTTACAGCATCCTCCCACGCAGG + Intergenic
904259869 1:29282375-29282397 GGTCCACGATCCTCTTAGCCTGG + Intronic
904498590 1:30901392-30901414 TTTCCATTTTCCTCCCAGCCAGG - Intronic
904777477 1:32919832-32919854 GGTACACCCGCCTCCCAGCCTGG + Intergenic
904785384 1:32978761-32978783 GTTTCACCATGTTGCCAGCCTGG + Intergenic
906391517 1:45421060-45421082 GTTCCACCATTTGCCCAGGCTGG - Intronic
907552808 1:55318697-55318719 TTTACAGCATCCTCCCAGCCTGG - Intergenic
913284800 1:117216468-117216490 GCTCCCCTATCCTCCTAGCCTGG + Intergenic
913359223 1:117961238-117961260 GTGCCACCAGCATTCCAGCCTGG + Exonic
915097773 1:153475845-153475867 GTTCCACCAACCTCCAGGCCCGG + Intergenic
915571831 1:156749090-156749112 GTCACACCATCCTTCCAGGCAGG + Intronic
915899583 1:159836751-159836773 GTTCCCAGATCCTCCCTGCCTGG + Exonic
916015967 1:160750208-160750230 CTGCCACCTTCCTCCCAGCCTGG - Intronic
917200630 1:172510789-172510811 GTGCCACTATACTTCCAGCCTGG - Intergenic
920314273 1:205066366-205066388 GAGCCAACCTCCTCCCAGCCAGG - Intronic
920328038 1:205182345-205182367 GTACCACTGTACTCCCAGCCTGG + Intronic
920416266 1:205800922-205800944 GTGCCCCACTCCTCCCAGCCAGG + Intronic
921269271 1:213452733-213452755 GCTCCACCCTCCTCCCAGGCTGG + Intergenic
1062958251 10:1554221-1554243 TCTCCAGCATCCACCCAGCCAGG + Intronic
1063658388 10:8014404-8014426 GTTCATTCATCCTCTCAGCCAGG - Intronic
1064231124 10:13529517-13529539 TTTCCACAATCCGCCCAGCCTGG - Intergenic
1065544003 10:26800542-26800564 GTTCAACCATCCTCCCACCTTGG - Intronic
1066265057 10:33768713-33768735 GTTTCACCATTTTCCCAGGCTGG - Intergenic
1069558547 10:69413689-69413711 CCTCCAACATCCTCCCTGCCTGG - Intronic
1069686574 10:70322841-70322863 GTCCCACCTCCCACCCAGCCAGG + Intronic
1069718298 10:70534500-70534522 CTTCCACCATCCTCCTTCCCTGG - Exonic
1069798622 10:71068929-71068951 GTGCCAGGATCCTCCCAGCTGGG + Intergenic
1069934629 10:71906639-71906661 GTTTCACCATGTTCCCAGGCTGG - Intergenic
1071815690 10:89230499-89230521 GTTTCACCATGTTCCCAGGCTGG + Intronic
1072182068 10:92993998-92994020 ATTCATCCATCCTCCCTGCCAGG - Intronic
1072257908 10:93638405-93638427 TTGGCACCATCCTCTCAGCCTGG + Intronic
1073062303 10:100740040-100740062 CTTCGAGCCTCCTCCCAGCCAGG + Intronic
1074052683 10:109894334-109894356 GTTTCACCATGCTCCCAGGCTGG - Intronic
1074528081 10:114278599-114278621 GTTCCACCACACTTCCAGGCTGG - Intronic
1076187309 10:128459761-128459783 GCACCACCATCCTCCCAGCCTGG + Intergenic
1076444147 10:130500378-130500400 GCTCCACCAGGCTCCCTGCCTGG - Intergenic
1076572413 10:131441326-131441348 ATTCCACCTTCCTTCCAGCTGGG - Intergenic
1076799575 10:132814375-132814397 GTTCTACCATCACCCCACCCGGG - Intronic
1080501691 11:32877468-32877490 GTCACACCATCCTCCCACCTCGG - Intergenic
1081596120 11:44460780-44460802 GTTCCAGCACCCTCCCTGCCAGG - Intergenic
1082988396 11:59186848-59186870 TCTCCTCCATCCTCCCATCCTGG + Intronic
1082998115 11:59268683-59268705 ATCCCACCATACTCACAGCCAGG + Intergenic
1083549464 11:63575510-63575532 GTACCTCCATCCTCCATGCCTGG - Intronic
1083891304 11:65596963-65596985 GTTCCACCCACCTCCCAGTATGG - Intronic
1085485800 11:76861419-76861441 GGTCCTCCACTCTCCCAGCCTGG - Intronic
1085510537 11:77085932-77085954 GTCACAGCCTCCTCCCAGCCTGG - Intronic
1085646349 11:78225803-78225825 GTCCCACCAACCTCTCTGCCTGG + Intronic
1085682884 11:78594745-78594767 GGTCCTCTATCCTCCTAGCCTGG - Intergenic
1085885737 11:80519618-80519640 GTTACACCTTCCAACCAGCCTGG - Intergenic
1086405293 11:86494205-86494227 TTTACACCATCCTCCCCTCCAGG - Intronic
1086970167 11:93072927-93072949 GATCCTCTATCCTCCTAGCCTGG - Intergenic
1087012444 11:93526759-93526781 GTTCCACCTGCCTCCCAGGATGG - Intronic
1087174923 11:95088032-95088054 CTGCCACCATCCTACCATCCTGG + Intergenic
1087178242 11:95115807-95115829 GTTCAACCATCCTTGCATCCCGG + Intronic
1087663839 11:101019431-101019453 GGTGCACCACCCTCCCAGCTAGG - Intergenic
1088209527 11:107439134-107439156 GTCCCACCATCCTTCCAGTACGG + Exonic
1088982040 11:114872638-114872660 ATTGCACCTTCCTCCCTGCCTGG + Intergenic
1089767633 11:120779406-120779428 CTTCCACCATGCCCCCAACCAGG - Intronic
1090731374 11:129575683-129575705 GCTCCACCAGCTTCCCATCCTGG + Intergenic
1091250624 11:134141236-134141258 TGACCACCATCCTCCCACCCGGG - Intronic
1091251876 11:134150882-134150904 GTTTCACTTTCCTCCCCGCCAGG - Exonic
1092161026 12:6315694-6315716 GAGCCCCCATCCTCCCAGACTGG + Intronic
1094079700 12:26519996-26520018 CTCCCACCTACCTCCCAGCCAGG - Intronic
1094358167 12:29600807-29600829 GTACCATCACCATCCCAGCCAGG - Intronic
1094578082 12:31706376-31706398 TTACCACCATCCCACCAGCCTGG + Intronic
1095406991 12:41877765-41877787 GTTTCACCATGTTCCCAGGCTGG - Intergenic
1097858638 12:64494266-64494288 GTTTCACCATGTTCCCAGGCTGG - Intronic
1100493699 12:95105006-95105028 GTTCCTTCATTCTCTCAGCCAGG - Exonic
1101346790 12:103893273-103893295 GTTCCACTGTCCTCACATCCGGG + Intergenic
1102185203 12:110942265-110942287 GTTCAAGCATCCTCCCACCTTGG + Intergenic
1103490703 12:121317294-121317316 GTGACACCGTACTCCCAGCCTGG - Intronic
1103738380 12:123075417-123075439 ATTCCACCATGCTGCAAGCCAGG + Intronic
1105214096 13:18274271-18274293 GCTTCCCCATCCTCCCAGCCAGG - Intergenic
1106755682 13:32820942-32820964 GTTTCACCATGTTCCCAGGCTGG - Intergenic
1107735570 13:43395319-43395341 GTTCCACCATGTTGCCAGGCTGG - Intronic
1109276716 13:60311771-60311793 GTCCCAGCTCCCTCCCAGCCAGG - Intergenic
1112120218 13:96401767-96401789 GTTTCACCATGCTGCCAGGCTGG + Intronic
1114419536 14:22569637-22569659 TTTTCTCCATCCTCCCAGCTTGG - Intronic
1116739740 14:48739273-48739295 CTTCCTCCATCCTCAAAGCCAGG + Intergenic
1118017699 14:61676565-61676587 GTTCCACCATCCTATCAGGCTGG + Intergenic
1118277743 14:64400643-64400665 GTGCCACTGTACTCCCAGCCTGG + Intronic
1118709233 14:68506197-68506219 GAGCCTCCGTCCTCCCAGCCAGG + Intronic
1119485373 14:74983317-74983339 ATGCCACAATCATCCCAGCCTGG + Intergenic
1119585237 14:75827910-75827932 GTTTCACCATGTTCCCAGACTGG + Intronic
1119891355 14:78184860-78184882 GTTCCTCCATCCACCCAGCAAGG - Intergenic
1121253402 14:92515146-92515168 CTCCCTCCATCCTGCCAGCCCGG + Intronic
1121358211 14:93232351-93232373 CTTCCTCCCTCCTCCCAGGCAGG + Intergenic
1121452795 14:94020178-94020200 GTTGCCCCATCCAGCCAGCCAGG + Intergenic
1122742553 14:103880674-103880696 GCTCCCCCACCCTCCTAGCCCGG + Intergenic
1125524242 15:40365207-40365229 GCTCCACCATTCTCCGAGGCCGG - Exonic
1125729976 15:41887636-41887658 ATTCCTCCAGCCCCCCAGCCTGG - Intronic
1126098485 15:45105828-45105850 GTGCCGCCTTCCTCCCACCCAGG - Exonic
1126114628 15:45197657-45197679 GTTTCCCCATCTCCCCAGCCTGG + Intronic
1127956118 15:63855059-63855081 GTTCCTCCATCTTCAAAGCCAGG + Intergenic
1129162473 15:73754092-73754114 CTCCCACCCTCCTCCCTGCCTGG - Intergenic
1129209763 15:74061006-74061028 CTGCCACCATCTTCTCAGCCTGG - Intergenic
1129280135 15:74478652-74478674 GTTTCACCATGTTGCCAGCCTGG - Intergenic
1129477296 15:75794757-75794779 CTGCCACCATCTTCTCAGCCTGG + Intergenic
1130180446 15:81621648-81621670 GTTTCACCATGTTCCCAGGCTGG - Intergenic
1130426040 15:83801041-83801063 TTTCTACCATCCTCCCAGTTTGG + Intronic
1130460815 15:84157293-84157315 GTTCCCCCATAAGCCCAGCCTGG - Intergenic
1133286421 16:4692954-4692976 TTTCCAGCATCCTCCAAGCCGGG - Intergenic
1135074522 16:19382055-19382077 GTTTCACCATGTTCCCAGGCTGG - Intergenic
1136177279 16:28526117-28526139 GTTTCACCATGTTGCCAGCCTGG + Intergenic
1138413177 16:56855484-56855506 GGTCCACCATGGCCCCAGCCTGG + Intergenic
1140931068 16:79628577-79628599 GTTTCACCTTCCTCACAGCTGGG + Intergenic
1141598622 16:85112291-85112313 CTTCCACCTCCCTCACAGCCAGG + Intronic
1142610808 17:1108574-1108596 GGGCCACCCTCTTCCCAGCCAGG - Intronic
1142689343 17:1595638-1595660 GTTTCACCATGCTGCCAGGCTGG + Intronic
1143277419 17:5722067-5722089 GGTCCACCATGCCCCAAGCCTGG - Intergenic
1143783828 17:9242692-9242714 GATCCACCATGCTAGCAGCCAGG + Exonic
1143857786 17:9865127-9865149 GCTCCACCACCCACCCACCCAGG + Intronic
1144629887 17:16865662-16865684 GGTGCAGCATCCTCCCAGCTTGG - Intergenic
1144651543 17:17010455-17010477 GGTGCAGCATCCTCCCAGCTTGG + Intergenic
1146064052 17:29621687-29621709 GCTCCACAATCCCCTCAGCCTGG - Intronic
1146401596 17:32504265-32504287 CTGCCACCACCCTCCCAGCCTGG + Intronic
1146603146 17:34235740-34235762 CATCCTTCATCCTCCCAGCCAGG + Intergenic
1146806377 17:35868246-35868268 CTTCCCTTATCCTCCCAGCCAGG - Intronic
1146823620 17:36004345-36004367 GCTCCTCTATCCTCCTAGCCTGG + Intergenic
1147205693 17:38835777-38835799 GGTAAACCCTCCTCCCAGCCTGG - Intronic
1148352439 17:46950666-46950688 GCCCCACCATCCTGCCTGCCCGG + Intronic
1148886835 17:50779999-50780021 GTGCCACTACCCTCCCAGCTGGG + Intergenic
1149636514 17:58174859-58174881 GTTCCACACTCCTCCCAGCTTGG - Intergenic
1151189783 17:72389723-72389745 CTTCCACCATCTTCAAAGCCAGG + Intergenic
1151355366 17:73555008-73555030 CATCCTCCTTCCTCCCAGCCTGG - Intronic
1151569540 17:74919419-74919441 GCTCCTCCATCCCCCCCGCCAGG + Intronic
1151847152 17:76664598-76664620 GTTCCACCATGATTCCATCCAGG - Intergenic
1151863708 17:76785532-76785554 GTTTCACCATGCTGCCAGGCTGG + Intergenic
1151880161 17:76889875-76889897 GTCCCACCTCCCTCCCAGCCCGG - Intronic
1152019138 17:77771442-77771464 GTTCCCCGATCTCCCCAGCCTGG + Intergenic
1152101574 17:78304754-78304776 GTTCCCCCATCCTGCCAGTGTGG + Intergenic
1152538195 17:80962387-80962409 GTTCCACCGTCCCCCTGGCCAGG + Intronic
1153442266 18:5133218-5133240 GTTCCATCTTCCTCGCGGCCCGG - Intergenic
1153528626 18:6021204-6021226 GCTCCTCTATCCTCACAGCCTGG - Intronic
1154249542 18:12732244-12732266 GTTGAACCATCCTCACATCCAGG - Intergenic
1154354806 18:13616663-13616685 AGACCACCATCCTCACAGCCTGG - Intronic
1155131564 18:22939898-22939920 CTTCCACCATCTTCCTTGCCTGG - Intronic
1155329880 18:24704248-24704270 GTTTCACCATATTCCCAGGCTGG - Intergenic
1155501470 18:26491267-26491289 GGGCCTCAATCCTCCCAGCCTGG + Intronic
1155560504 18:27071088-27071110 CTTCCACTATCCTTCCACCCTGG + Intronic
1155574265 18:27227910-27227932 GCTCCTCCATCCTCCTAACCTGG + Intergenic
1157288671 18:46394499-46394521 CCTCCACCTTCCCCCCAGCCAGG + Intronic
1157424272 18:47571550-47571572 TTTCCACCAGCCTCCAAGCAGGG + Intergenic
1158093315 18:53740918-53740940 GGTCCAGCAACCACCCAGCCAGG - Intergenic
1158686898 18:59622756-59622778 GTGCCACTACCCTCCAAGCCTGG + Intronic
1160875498 19:1294631-1294653 GTTCCACCTGCCGCCCAGCTCGG - Intronic
1161070014 19:2255340-2255362 GTTCCCCACCCCTCCCAGCCTGG - Exonic
1161120029 19:2520643-2520665 GTTCCACCAGCTTCCGGGCCTGG + Exonic
1161447975 19:4328629-4328651 TTCCCACCCTCCTCCCACCCAGG + Intronic
1161575206 19:5051163-5051185 GACCCAACATCCTCCCACCCCGG - Intronic
1161719788 19:5896411-5896433 CCCCCACCCTCCTCCCAGCCTGG - Intronic
1162054743 19:8055910-8055932 GTTCCACACCCTTCCCAGCCGGG + Intronic
1162362125 19:10226815-10226837 GCTGCCCCATCCTCCCAGCCAGG - Intronic
1162622710 19:11856689-11856711 GTTTCACCTGCCTCACAGCCAGG - Intronic
1164907301 19:31977821-31977843 CTCCCGGCATCCTCCCAGCCAGG + Intergenic
1166213860 19:41323510-41323532 CTGCCCCCATCCTCCCTGCCTGG - Exonic
1167612804 19:50515377-50515399 GTGCCAGCAACCCCCCAGCCAGG + Intergenic
1167658798 19:50783547-50783569 CTTCCTCCCTCCTCCCTGCCTGG - Intergenic
1168100440 19:54138369-54138391 GCGCCTCCATCCTTCCAGCCAGG - Intronic
1168327716 19:55546641-55546663 GTTCCTCCATCCTCAGACCCAGG + Intergenic
1168327789 19:55546863-55546885 GTTCCTCCATCCTCAGACCCAGG + Intergenic
927829589 2:26337978-26338000 GTGCCACTGCCCTCCCAGCCTGG + Intronic
928120154 2:28578119-28578141 GGTCCACCAGCCTCCTGGCCTGG - Exonic
928308680 2:30192160-30192182 GGTCCACCCTCCTCTAAGCCTGG - Intergenic
930015852 2:46970182-46970204 GTTTCACCATGTTCCCAGGCTGG + Intronic
930189187 2:48440766-48440788 ACTCCACCTTCCTCCCACCCCGG + Intronic
930808146 2:55512597-55512619 GTTCCACCATGTTGCCAGGCTGG + Intergenic
931088932 2:58865117-58865139 GGTCAGCCTTCCTCCCAGCCAGG + Intergenic
932433975 2:71692341-71692363 TTTCCACCACCCGCCTAGCCTGG + Intergenic
932826713 2:74947959-74947981 GTTCCACCCTTCCCCCACCCAGG - Intergenic
933736394 2:85498804-85498826 GTTTCACCATCTGGCCAGCCTGG + Intergenic
933771414 2:85746760-85746782 ATCCCACCATCTTTCCAGCCTGG + Intergenic
934025155 2:87996358-87996380 CTTTCACCTTCCTCCCAGGCTGG - Intergenic
934300223 2:91772479-91772501 GCTTCCCCATCCTCCCAGCCAGG + Intergenic
936683795 2:114804393-114804415 GGGCCACCATCCTCCCAGAATGG + Intronic
937044797 2:118845516-118845538 GTTCCCGCATCCTCCCCGCGCGG - Intronic
938035321 2:128030020-128030042 GTTCCACCATATGCCCAGGCTGG + Intergenic
938573096 2:132580575-132580597 GTTCCACCATATCCCAAGCCAGG + Intronic
938956863 2:136307044-136307066 GCTGCACCTCCCTCCCAGCCTGG - Intergenic
939540329 2:143485921-143485943 ATTCCACCCTTCTCCCAGCTAGG + Intronic
940110425 2:150146724-150146746 GCTCCTCTATCCTCCTAGCCTGG + Intergenic
940292972 2:152095846-152095868 GTTTCACCATGCTACCAGGCTGG + Intronic
943120059 2:183724453-183724475 GCTCCTCTATCCTCCTAGCCTGG + Intergenic
944086332 2:195851662-195851684 GATGTACCATCCTCCCAACCAGG - Intronic
947587405 2:231365041-231365063 GGCCCTCCATCCTCCCAGCATGG + Intronic
947648947 2:231768038-231768060 GTTTCACCATGTTCCCAGGCTGG + Intronic
948560971 2:238851434-238851456 CTTCCCCCACCCTCCAAGCCAGG - Intronic
948641032 2:239376059-239376081 GTTCCACCATCCAAACAGCAAGG + Intronic
948781144 2:240322685-240322707 CTTCCACCGTCCTCCCAGCTGGG - Intergenic
1168906697 20:1409746-1409768 GGGCCACCCTCCTCCCAACCTGG + Intergenic
1170771942 20:19340574-19340596 TTTCCACCATCCCCACAGCCTGG + Intronic
1171499265 20:25580527-25580549 CTTCCATCATCCTCCAAGCGAGG - Intronic
1176082378 20:63280372-63280394 GCTCAACCATCCTCCCACCTGGG + Intronic
1176367588 21:6043232-6043254 GTTCCACCATCTGACCAGGCAGG - Intergenic
1177254803 21:18647208-18647230 GTTTCACCATCTTGCCAGGCTGG + Intergenic
1178952439 21:36996132-36996154 GAGCCACCATGCTCCCGGCCTGG - Intergenic
1179320985 21:40291098-40291120 CTTCCACTATCCTCACTGCCTGG + Intronic
1179603408 21:42496285-42496307 GTCCCGCCTCCCTCCCAGCCCGG + Exonic
1179755931 21:43495310-43495332 GTTCCACCATCTGACCAGGCAGG + Intergenic
1180118673 21:45729901-45729923 GTTCCACCATCTACCATGCCTGG + Intronic
1180149577 21:45940795-45940817 GTACCACCAGCCCCCCAGCCAGG + Intronic
1181236994 22:21453477-21453499 GTTTCACCATCTTGCCAGGCTGG - Intergenic
1181698581 22:24607609-24607631 GCTTCCCCATCCTCCCAGCCAGG + Intronic
1183301546 22:37061385-37061407 GTACCTCCTGCCTCCCAGCCTGG + Intronic
1183949002 22:41342365-41342387 CTTCCTCCACCCTCCCAGCCAGG - Intronic
1184088965 22:42282643-42282665 GTTCCATCATTCTCTTAGCCTGG - Intronic
952832830 3:37579323-37579345 GTTCCACCATCCTCAGAACATGG + Intronic
953600662 3:44360644-44360666 GTGCCACCACACTCCCCGCCTGG - Intronic
954360781 3:50121739-50121761 ATTCCATCATCTTTCCAGCCAGG + Intergenic
956084737 3:65597508-65597530 CCTCCCCCTTCCTCCCAGCCTGG + Intronic
957043045 3:75351598-75351620 GGTCCACTATCCTCCCTGCGTGG + Intergenic
959458426 3:106592713-106592735 GTTTCACCATCTTGCCAGGCTGG + Intergenic
962140883 3:132789440-132789462 GTTCCACCATGCTGGCACCCTGG + Intergenic
962163100 3:133020170-133020192 GTTCCTACATCCTCCCTGCTGGG - Intergenic
962271517 3:133980943-133980965 GTGCCACCATGCCCCCAGACAGG - Intronic
962795407 3:138845540-138845562 GTTTCACCATGCTGCCAGGCTGG + Intergenic
963247842 3:143079128-143079150 CTTCCACCATTCTCCAAGCCTGG - Intergenic
966443449 3:179974105-179974127 TCTCCTCCCTCCTCCCAGCCGGG + Intronic
966973629 3:185066982-185067004 GCTCCTCTATCCTCCTAGCCTGG + Intergenic
967261622 3:187648474-187648496 CTTCCACCATCTTCAAAGCCAGG + Intergenic
969519290 4:7666451-7666473 CTTCCTCCCTCCTCCCACCCTGG + Intronic
969594343 4:8140475-8140497 TTTCCCCCATGCTCCCCGCCAGG - Intronic
969954959 4:10879714-10879736 ATACCACCATCCTCCCATTCAGG - Intergenic
976121693 4:81790578-81790600 TATCCACCTTCTTCCCAGCCAGG + Intronic
976398685 4:84583633-84583655 GGTGCACCTTCCTCCCTGCCTGG + Intronic
977871048 4:102091295-102091317 GTTTCACTATCTTCCCAGCCTGG - Intergenic
978558323 4:110004775-110004797 GTTCCCCCACCCTCCCACCCAGG - Intronic
978896795 4:113898242-113898264 TCTCCACCATCCTCCCACCATGG - Intergenic
981458306 4:144982039-144982061 GTTTCACCATGCTGCCAGGCTGG + Intronic
984501431 4:180564181-180564203 GTCCCACCCTCCATCCAGCCAGG - Intergenic
984692311 4:182740979-182741001 GTTCCACCATGTTGCCAGGCTGG - Intronic
986034862 5:3927760-3927782 CCCCTACCATCCTCCCAGCCAGG + Intergenic
986332735 5:6729614-6729636 GATCCACCTGCCACCCAGCCTGG - Intronic
986571448 5:9170189-9170211 GTTCCTCCACCCTACCAGGCTGG - Intronic
987757142 5:22110780-22110802 GCTCCTCTATCCTCCTAGCCTGG + Intronic
988096635 5:26621217-26621239 GTGCCACCATCCACCAAGACTGG - Intergenic
988595325 5:32585660-32585682 GGGCCCCCACCCTCCCAGCCGGG + Intronic
989034000 5:37150572-37150594 GCTCCACCATTCACCCAGGCTGG + Intronic
990910798 5:60850364-60850386 CTTAAACCATCCTCCCACCCTGG + Intergenic
991298947 5:65109001-65109023 ATTCTACCCTCCTTCCAGCCTGG + Intergenic
991596963 5:68315929-68315951 GTTCCCACATCCTTCCAGGCAGG - Intergenic
992952949 5:81878686-81878708 TTCCCACCTTCCTCTCAGCCAGG - Intergenic
995485245 5:112633626-112633648 GTGCCACCATCCTCCTGGGCAGG + Intergenic
996151177 5:120036699-120036721 GTTCCACCATCCTGCTTGCTGGG + Intergenic
999730909 5:154476281-154476303 CTTCCGCCAGCCTCCCAACCTGG + Intronic
999801991 5:155046850-155046872 GTTCCAGCCTACTCCCTGCCAGG - Intergenic
1000089935 5:157921519-157921541 GCTCCTCTATCCTCCTAGCCTGG + Intergenic
1002285942 5:178162774-178162796 GTGCCTCCATCCTCACAGCCGGG - Intergenic
1002296978 5:178237183-178237205 GTTTCACCATGCTGCCAGCCTGG + Intergenic
1002363594 5:178693268-178693290 GTGCCACCATACTCCAAGCTGGG + Intergenic
1003128668 6:3376819-3376841 TCTCCCCCACCCTCCCAGCCAGG - Intronic
1003268614 6:4588286-4588308 GCGCCCCCATCTTCCCAGCCAGG - Intergenic
1003631969 6:7795397-7795419 GTTCCTCCATCCCCTCAGCCTGG - Intronic
1004266145 6:14150159-14150181 TTTCCTCCAACCTACCAGCCAGG - Intergenic
1006751114 6:36377774-36377796 GCTCCTCCCTCCTGCCAGCCTGG - Intronic
1007073108 6:39050339-39050361 GTTCCATCCTCCTCCAGGCCAGG + Intronic
1010380460 6:75218220-75218242 GTTCCAGTGTCCTCCCAGACTGG + Intergenic
1011591510 6:88974691-88974713 GCACCACCACACTCCCAGCCTGG + Intergenic
1012852565 6:104464601-104464623 GTTTCACCATGTTCCCAGGCTGG - Intergenic
1013288504 6:108700065-108700087 ATACCACCACCCTCGCAGCCTGG + Intergenic
1013345623 6:109257576-109257598 GTTCCACCCTTCCCTCAGCCTGG + Intergenic
1013349357 6:109291555-109291577 CTTCCACCAGCCTCCCAACAAGG + Intergenic
1013591456 6:111622466-111622488 TTTCCACCATACCCACAGCCTGG - Intergenic
1013608438 6:111772523-111772545 GTTCCACCATCCTCAGTGCTAGG - Intronic
1017690315 6:156957460-156957482 GTTCCAGCATCCTGGCTGCCAGG + Intronic
1017780020 6:157708524-157708546 GTTCCTCTATCCTCCTAGCCTGG + Intronic
1017912001 6:158801307-158801329 GTTTCACCATGTTGCCAGCCAGG + Intronic
1019285788 7:222301-222323 GTCCCTCCATCCTCACTGCCGGG - Intronic
1019334646 7:477218-477240 GTTCCAGCTGCCTCCCACCCTGG + Intergenic
1020677862 7:11201987-11202009 GTACCCCCATCCTCCCAAACAGG + Intergenic
1022445817 7:30469887-30469909 TTTCCTCCATCCCCCCAGCGGGG + Intronic
1022903375 7:34832336-34832358 GTTTCACCATGCTGCCAGGCTGG - Intronic
1024238668 7:47416894-47416916 GTTCCGCCCTCCTTCCAGCACGG + Intronic
1024906110 7:54382471-54382493 GGTCCACAATGCTCTCAGCCAGG + Intergenic
1025006101 7:55356225-55356247 GTTCCACCATGTTGCCAGGCTGG + Intergenic
1025919532 7:65898279-65898301 GTTTCACCATCTTGCCAGGCTGG + Intronic
1026466817 7:70661438-70661460 CTGCCACCCTCCTCCCACCCTGG - Intronic
1027244492 7:76358352-76358374 CTTCCCCCCTCCTCCTAGCCTGG - Intronic
1027805910 7:82822246-82822268 TTTCCACCATCCATCCAACCTGG - Intronic
1027995887 7:85424545-85424567 CTTCCACCATCCACTCGGCCTGG - Intergenic
1028600919 7:92599541-92599563 GTTTCACCATGTTCCCAGGCTGG + Intergenic
1029507554 7:100971479-100971501 GTTCCACCATCCTCCCAGCCAGG + Intronic
1031145964 7:117996783-117996805 GTTCCACCATGCTCAAGGCCAGG - Intergenic
1031798223 7:126206169-126206191 CTTCCTGCATCCTCCCATCCTGG - Intergenic
1033481654 7:141747801-141747823 GTTTCACCATGTTCCCAGGCTGG - Intronic
1034197477 7:149259483-149259505 GCTCCCTCATCCTCCAAGCCAGG - Intergenic
1035368228 7:158362061-158362083 CTACCATCAACCTCCCAGCCTGG + Intronic
1035640551 8:1181833-1181855 GTACCACCTTCCTCCCTGCACGG + Intergenic
1035727716 8:1834960-1834982 TTTCCTCCATCCTCCCACCTGGG - Intronic
1037855980 8:22370872-22370894 ATTCCACCAGCCCACCAGCCTGG - Intronic
1037934727 8:22907837-22907859 GGGTCACCATCCTCCCAACCTGG - Intronic
1037994661 8:23343467-23343489 GTTCCTCCTGCCTTCCAGCCCGG - Intronic
1039441759 8:37599909-37599931 GTTTCACAACCCTCCTAGCCAGG - Intergenic
1040036939 8:42879715-42879737 GTAGCACTATACTCCCAGCCTGG - Intronic
1041074905 8:54160618-54160640 GTTCCACAATTCTCTCAGGCAGG - Intergenic
1042376904 8:68062089-68062111 GTACCACCATCCACCCAGCTAGG + Intronic
1042846186 8:73171691-73171713 GTTTCACCATGTTCCCAGGCTGG - Intergenic
1043407160 8:79949216-79949238 GTTTCACCATCTTGCCAGGCTGG - Intronic
1043968448 8:86505078-86505100 CTTCCACCTCCCTCCCAGCATGG + Intronic
1044586701 8:93875229-93875251 GCTCCTCTATCCTCCTAGCCTGG + Intronic
1045112301 8:98947461-98947483 GTGCCACCAACCGCCAAGCCTGG - Intronic
1046366079 8:113234931-113234953 GTTCGACCATGCCACCAGCCAGG + Intronic
1049217237 8:141413814-141413836 GTGCCATCCTCCTTCCAGCCTGG + Intronic
1049271083 8:141696644-141696666 CCTCCACCTTCCTTCCAGCCTGG + Intergenic
1049388762 8:142357545-142357567 GCTCCACCCTCCTCCCTCCCGGG - Intronic
1051408071 9:16760459-16760481 TATCCAACCTCCTCCCAGCCAGG - Intronic
1053173955 9:35909315-35909337 TTTCCACCCTCCTCCCTGCCAGG - Intergenic
1054724285 9:68634801-68634823 GTTCCACCATCCAGGGAGCCAGG + Intergenic
1058321822 9:103641597-103641619 GTTCCACCATCATCAGTGCCTGG - Intergenic
1058818461 9:108707010-108707032 GCTCCACCATCAGCTCAGCCAGG + Intergenic
1059971508 9:119673383-119673405 ACTCCTCCATCCTCCCACCCTGG - Intergenic
1061741723 9:132711544-132711566 GTTTCACCATACTGCCAGGCTGG + Intergenic
1061991477 9:134161578-134161600 GTTTCACCATGCTGCCAGGCTGG + Intergenic
1062033343 9:134371941-134371963 TTCCCAACATCCTGCCAGCCTGG + Intronic
1062393242 9:136342388-136342410 GTTCCAGCGTCCTCCCACTCCGG - Intronic
1188686350 X:33074993-33075015 TTTCCCCTATCCTCCTAGCCTGG - Intronic
1189271942 X:39758110-39758132 TTTCCACAGTCCTCCCAGACCGG + Intergenic
1189749154 X:44202216-44202238 GTTTCACCATCTTGCCAGGCTGG - Intronic
1190944646 X:55079729-55079751 GTTGAACCATCCTTCCATCCCGG + Intergenic
1190945889 X:55093662-55093684 GTTGAACCATCCTTCCATCCCGG + Intronic
1193102525 X:77631378-77631400 TTTCCACCATCCTCCCATTCAGG + Intronic
1194654068 X:96549852-96549874 GTTTCACCATCCGGCCAGACTGG + Intergenic
1199192811 X:144991421-144991443 GATCCACCATTCTCCCTTCCTGG - Intergenic
1199295194 X:146149231-146149253 CTTCCAATATCTTCCCAGCCTGG + Intergenic
1202378437 Y:24257887-24257909 GTTCCGCCATAAGCCCAGCCTGG + Intergenic
1202492345 Y:25412234-25412256 GTTCCGCCATAAGCCCAGCCTGG - Intergenic