ID: 1029507555

View in Genome Browser
Species Human (GRCh38)
Location 7:100971480-100971502
Sequence TTCCACCATCCTCCCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029507550_1029507555 2 Left 1029507550 7:100971455-100971477 CCTTCGAGGTAACCCACCAGGGA 0: 1
1: 0
2: 0
3: 9
4: 60
Right 1029507555 7:100971480-100971502 TTCCACCATCCTCCCAGCCAGGG 0: 1
1: 0
2: 2
3: 46
4: 336
1029507551_1029507555 -10 Left 1029507551 7:100971467-100971489 CCCACCAGGGAAGTTCCACCATC 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1029507555 7:100971480-100971502 TTCCACCATCCTCCCAGCCAGGG 0: 1
1: 0
2: 2
3: 46
4: 336
1029507546_1029507555 14 Left 1029507546 7:100971443-100971465 CCCTGCAGGACACCTTCGAGGTA 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1029507555 7:100971480-100971502 TTCCACCATCCTCCCAGCCAGGG 0: 1
1: 0
2: 2
3: 46
4: 336
1029507547_1029507555 13 Left 1029507547 7:100971444-100971466 CCTGCAGGACACCTTCGAGGTAA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1029507555 7:100971480-100971502 TTCCACCATCCTCCCAGCCAGGG 0: 1
1: 0
2: 2
3: 46
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029507555 Original CRISPR TTCCACCATCCTCCCAGCCA GGG Intronic
900145441 1:1157171-1157193 TTCTACCATGCTGCCAGACAAGG - Intergenic
900189299 1:1346510-1346532 TTCTGCCCTCCTCCCAGCCCTGG + Intronic
900410689 1:2511200-2511222 TCTCACCATCCTGCGAGCCAAGG - Intronic
900491509 1:2951582-2951604 TCCCACCATCCTCTTATCCAAGG + Intergenic
900808495 1:4783689-4783711 ATCCACCACCCACCCAACCAGGG - Exonic
901414081 1:9105135-9105157 TCCCCCCATCCTCCCCGCCATGG + Intronic
901455092 1:9358598-9358620 TGCCTCCCTCCTCCCAGCCATGG + Intronic
901843170 1:11966291-11966313 CTCCACCAGCTTCCCTGCCAGGG - Exonic
902951853 1:19890598-19890620 ATCCTCCCCCCTCCCAGCCAAGG + Intronic
903423864 1:23238599-23238621 TTTCACCTTCCTGCCAGCCCAGG - Intergenic
903686419 1:25135500-25135522 TTCCTCCAACATCTCAGCCATGG + Intergenic
904386498 1:30145955-30145977 TGCCACCATCCTCCCTCCCCTGG - Intergenic
904498589 1:30901391-30901413 TTCCATTTTCCTCCCAGCCAGGG - Intronic
907089355 1:51709879-51709901 GTCCAACATCCTCACAGGCATGG + Intronic
907242075 1:53086412-53086434 TTCCACCCTCCTCCCAGGGGTGG - Intergenic
908525568 1:64984572-64984594 TTCAACCTCCCTCCCAGCAAGGG - Intergenic
908683566 1:66689444-66689466 TTCTACCATCTTTCAAGCCAAGG + Intronic
909346114 1:74589628-74589650 TACCACCTTCCTCCAACCCAGGG + Exonic
912966128 1:114239261-114239283 TTCAGCCATCTTGCCAGCCACGG - Intergenic
915001160 1:152593543-152593565 TTGAACCATCCTCGCAGCCCTGG + Intronic
915091462 1:153429079-153429101 TTCCCCCTTGCTCCCAGCCCTGG - Intergenic
915117518 1:153609961-153609983 CTGCTCCATCCTCCCAGCCAAGG - Intronic
915707701 1:157862236-157862258 TTACACCATCCTATCAGCTATGG - Intronic
915721461 1:157988781-157988803 TTCCAAAGTCCTCCCAGCAAAGG - Intergenic
918969146 1:191391710-191391732 TTCAACCATCCTCTCATCCTAGG - Intergenic
919211542 1:194493209-194493231 GTCAATCATCCTCTCAGCCATGG - Intergenic
919327256 1:196124382-196124404 TTCCCCCATGCTTCCAGCGAGGG + Intergenic
919879609 1:201893062-201893084 TTTCACCCTCCTGACAGCCATGG - Intergenic
922053794 1:222020951-222020973 CTCCTGCATCCTCCCAGACATGG - Intergenic
922875486 1:228936923-228936945 ATCTACCAGCCACCCAGCCATGG - Intergenic
924777558 1:247120413-247120435 GTCCACCCTGCACCCAGCCAGGG - Intergenic
1062958252 10:1554222-1554244 CTCCAGCATCCACCCAGCCAGGG + Intronic
1064231123 10:13529516-13529538 TTCCACAATCCGCCCAGCCTGGG - Intergenic
1065819582 10:29513111-29513133 ATGCACCATCATTCCAGCCAAGG + Intronic
1065953275 10:30671293-30671315 ATGCACCATTATCCCAGCCAAGG - Intergenic
1067412884 10:46079941-46079963 TTCCTCCATCTTCCCCACCAAGG - Intergenic
1067964167 10:50890150-50890172 TGCCACCATCCTCCCTGCCCTGG + Intergenic
1067980904 10:51083245-51083267 TTCCCCTTTCCTGCCAGCCAGGG + Intronic
1068793506 10:61052606-61052628 TGCCACCATCCTAACAGACATGG - Intergenic
1069368799 10:67722065-67722087 TTCAGCCATCTTGCCAGCCATGG + Intergenic
1069640962 10:69955345-69955367 TTCCACCATCCACGCACCAATGG + Intronic
1069686575 10:70322842-70322864 TCCCACCTCCCACCCAGCCAGGG + Intronic
1069718297 10:70534499-70534521 TTCCACCATCCTCCTTCCCTGGG - Exonic
1069854946 10:71434960-71434982 TTCCAACATGCTCACAGCCAAGG - Intronic
1069985570 10:72280664-72280686 TTCCATCTTGATCCCAGCCATGG + Intergenic
1070156948 10:73841139-73841161 CTGCAGCATCCTCACAGCCAAGG + Intronic
1070975490 10:80603035-80603057 TTCCCCCAACCACCCAGGCAGGG - Intronic
1071318563 10:84428216-84428238 ATCCCCCAACCTCCCACCCATGG - Intronic
1071473745 10:86006996-86007018 TTCCCCCATCCTCCCGCCCAAGG - Intronic
1072561323 10:96578013-96578035 TACTACCATTCTCTCAGCCATGG + Intronic
1073267139 10:102234563-102234585 CTCCCTCATCTTCCCAGCCAAGG - Intronic
1075244051 10:120804713-120804735 TTCCTCCAGCTTCCCAGGCATGG + Intergenic
1075486622 10:122827698-122827720 TTCCTGCATCCTCCCAGAGAAGG + Intergenic
1075609561 10:123841513-123841535 TTCCCCCTTCCTCCTAGCCCTGG + Intronic
1075910228 10:126118047-126118069 TTCCACCACCCTCTCAGACATGG - Exonic
1076068405 10:127466927-127466949 TTCCACAATCATCCCAGAGAGGG + Intergenic
1076187310 10:128459762-128459784 CACCACCATCCTCCCAGCCTGGG + Intergenic
1076521276 10:131082792-131082814 TTCCCCCATCGTACCAGCCCAGG + Intergenic
1076685653 10:132197433-132197455 TACCACCTTCCTTCCAGCCAAGG + Intronic
1077726717 11:4682360-4682382 ATCCACCATCCTGCTGGCCATGG - Exonic
1077955309 11:7013032-7013054 TTAGACCAGCCTGCCAGCCATGG - Intronic
1078191595 11:9095872-9095894 TTCCACCTTCTTCACAACCATGG - Intronic
1078266544 11:9759317-9759339 TTCCTCCAACATCCCAGCCCCGG - Intergenic
1078667515 11:13339011-13339033 GTACACCATCCACCCATCCAGGG - Intronic
1079451690 11:20604204-20604226 TTCCACCCTCCCCCCCGCTAGGG - Intronic
1079890119 11:26042054-26042076 TTCCCCCACCCTCCCATTCATGG - Intergenic
1080907647 11:36562650-36562672 TTCCTTCATCCACCCACCCAAGG - Intronic
1081038030 11:38174837-38174859 TTCCACCTTGCTCCCAACCTTGG + Intergenic
1083878665 11:65537728-65537750 CCCCAGCATCATCCCAGCCACGG - Intronic
1083896360 11:65621870-65621892 TGCTACCCTCCTCCCAGACAGGG - Intronic
1084430221 11:69106798-69106820 CTCCACCATCTTCCCACTCAGGG + Intergenic
1084637588 11:70402491-70402513 CACCACCATCCGCCCAGCCCTGG + Intronic
1085414772 11:76312710-76312732 CTCCACCATCGTCACAGTCATGG - Intergenic
1086261415 11:84945656-84945678 TTCCCCCAGCCTGCCAGCCCAGG + Intronic
1086405292 11:86494204-86494226 TTACACCATCCTCCCCTCCAGGG - Intronic
1086950650 11:92887171-92887193 CACCACCCTCCTCCCAACCATGG - Intronic
1087663838 11:101019430-101019452 GTGCACCACCCTCCCAGCTAGGG - Intergenic
1089153016 11:116378897-116378919 TTCTACCTTCCTCCCTTCCATGG - Intergenic
1089767632 11:120779405-120779427 TTCCACCATGCCCCCAACCAGGG - Intronic
1091139776 11:133224872-133224894 TTCCATCATCCTCCTAGGCTTGG + Intronic
1091614342 12:2037628-2037650 TTCCACCATCGTACCAGTCATGG + Intronic
1092527274 12:9316936-9316958 TCCCACCTTACTCCCAGTCATGG + Intergenic
1092540002 12:9414837-9414859 TCCCACCTTACTCCCAGTCATGG - Intergenic
1094099207 12:26742982-26743004 TTTCCCCCTCCTCCCAGCCCTGG - Intronic
1094513037 12:31107627-31107649 TCCCACCTTACTCCCAGTCATGG + Intergenic
1094739741 12:33275170-33275192 GTCCCTCATTCTCCCAGCCAGGG + Intergenic
1096612657 12:52813406-52813428 TCCCACCTTCCCACCAGCCACGG + Intronic
1096803146 12:54124869-54124891 CTCCCCTCTCCTCCCAGCCAAGG - Intergenic
1096871306 12:54594113-54594135 TTCCCCCGTCCTCCCAGGCTTGG + Intergenic
1099603814 12:84776080-84776102 TTTCTTCATCCTCCAAGCCATGG + Intergenic
1099810073 12:87569314-87569336 TTCCCCCACCATCCCATCCATGG + Intergenic
1102335790 12:112078673-112078695 TTCGACCATTCTCTCAGCAAGGG + Exonic
1102550269 12:113686468-113686490 TTTTACCATCCTCCAAGACAGGG - Intergenic
1103234201 12:119358576-119358598 CTCAAACATCCTCCCAGACATGG + Intronic
1103913920 12:124366421-124366443 ATCCTCCCTCCTCCCAGCCCTGG - Intronic
1104104539 12:125646515-125646537 TTCCAGCCTCCACCCAGCCCAGG + Intronic
1105587153 13:21756123-21756145 TTCCTCCCACCTCCGAGCCACGG + Intergenic
1106932265 13:34679444-34679466 TTCCACCCTTCTCCCAGGCATGG + Intergenic
1107794310 13:44034343-44034365 TGCCTCCATCCTCAAAGCCAGGG - Intergenic
1110395066 13:75020296-75020318 TTGCACCATACGCCCATCCACGG + Intergenic
1110577576 13:77077243-77077265 TTTCACCATCTTTCCAGCCCAGG + Exonic
1113140958 13:107148582-107148604 TTCCAGCCTCCTTCCAGCCGAGG + Intergenic
1113389005 13:109877921-109877943 ATCCACCACCCTGCCTGCCAGGG - Intergenic
1114065084 14:19053657-19053679 GTGCACCACCCTCCCAGCCTAGG + Intergenic
1114097178 14:19346345-19346367 GTGCACCACCCTCCCAGCCTAGG - Intergenic
1114331105 14:21637891-21637913 TTCCTGCCTCCTCCCAGGCAGGG - Intergenic
1118627657 14:67674290-67674312 TCCCACCTTCCTCCCAGACCCGG - Intronic
1118709984 14:68510979-68511001 CTCCACCTCCCTCCCATCCAAGG + Intronic
1118923373 14:70169962-70169984 TACCACCATCATCCCAGCCCAGG + Intronic
1119485374 14:74983318-74983340 TGCCACAATCATCCCAGCCTGGG + Intergenic
1119891354 14:78184859-78184881 TTCCTCCATCCACCCAGCAAGGG - Intergenic
1120565444 14:86049071-86049093 TTCATCCATCTTCCCACCCATGG + Intergenic
1120626138 14:86829289-86829311 TTTCACCATGTTGCCAGCCAGGG + Intergenic
1121124527 14:91397656-91397678 TTCCACCCTCCGCCCAACCCCGG + Intronic
1121846139 14:97173756-97173778 CTCCAGAATCATCCCAGCCAGGG + Intergenic
1121930814 14:97970666-97970688 TTCCACCATTCTCTCAGTCCAGG - Intronic
1122312066 14:100803775-100803797 TTCCCACAGCCTCCCGGCCAGGG - Intergenic
1122744350 14:103889220-103889242 CTGCACCCTCGTCCCAGCCATGG - Intergenic
1124571275 15:30866416-30866438 TTCCACCATTCTACCAGACCAGG + Intergenic
1125366487 15:38921744-38921766 TCAAACCATCCTCCCAGCTAAGG - Intergenic
1129071310 15:72953590-72953612 TTCCATCATCCAGCCAGGCACGG + Intergenic
1129209762 15:74061005-74061027 TGCCACCATCTTCTCAGCCTGGG - Intergenic
1129477297 15:75794758-75794780 TGCCACCATCTTCTCAGCCTGGG + Intergenic
1129742647 15:77997254-77997276 TTCCTCCATCCCCTCAACCAAGG + Exonic
1129842825 15:78754192-78754214 TTCCTCCATCCCCTCAACCAAGG - Intergenic
1133071371 16:3248858-3248880 TCCCACCTTCCTCCCAGGGACGG + Intronic
1133523155 16:6578421-6578443 TTCCATCAGCTACCCAGCCAAGG - Intronic
1136093372 16:27936372-27936394 TTCCACCCTCGTCCCACACAAGG - Intronic
1136105219 16:28025495-28025517 TTTCACCATCCTCCCAAGCCCGG + Intronic
1137785301 16:51133391-51133413 TTCCACCCACCCCCCCGCCACGG - Intergenic
1139358757 16:66383520-66383542 TCCCTCCATCCTCCCTGCCCTGG + Intronic
1139483942 16:67246032-67246054 GTCCTGCATCCTTCCAGCCATGG + Intronic
1141592140 16:85076509-85076531 TTCCAGCAACCTCCCACCTATGG - Intronic
1141900696 16:86988503-86988525 TTCCTCCACCGTCCCAGCCGTGG - Intergenic
1142261216 16:89043320-89043342 TGCCACCACCCTCCCCGCCATGG + Intergenic
1142562687 17:820195-820217 TACCACCATCATCACAGACAAGG - Intronic
1144019148 17:11224458-11224480 TTCCGCCATGCTCAGAGCCATGG - Intergenic
1146401597 17:32504266-32504288 TGCCACCACCCTCCCAGCCTGGG + Intronic
1146541283 17:33697616-33697638 TACCACCTTTCTCCCAACCATGG + Intronic
1147217875 17:38911535-38911557 TTCCCCCACCACCCCAGCCAGGG + Intronic
1148002403 17:44397575-44397597 CTGCAACATCCCCCCAGCCATGG - Exonic
1150623320 17:66824403-66824425 CTCCACCCTCCCCCCACCCATGG + Intergenic
1150802753 17:68294646-68294668 ACCCACCATGCTCCCACCCAGGG + Intronic
1151692831 17:75697387-75697409 TTCCTCCTTCTTCCCAGCCCTGG - Intronic
1152496209 17:80674078-80674100 TTTCACCATTCTCCCACCCAAGG + Intronic
1153344336 18:4009779-4009801 ATCCACCACCCTCCCAGGAATGG + Intronic
1153529709 18:6032709-6032731 TTCTCCCCTCCTCCCAGCCCTGG + Intronic
1154197934 18:12279741-12279763 TTCCACCAGTCTCCTGGCCAAGG - Intergenic
1154249541 18:12732243-12732265 TTGAACCATCCTCACATCCAGGG - Intergenic
1157402618 18:47400804-47400826 CACAACCATCCTCCCACCCAGGG + Intergenic
1157402744 18:47401304-47401326 CACAACCATCCTCCCACCCAGGG + Intergenic
1157504145 18:48214296-48214318 TTCTTCCCTCCTCCCAGCCATGG + Intronic
1158093314 18:53740917-53740939 GTCCAGCAACCACCCAGCCAGGG - Intergenic
1159971866 18:74665394-74665416 CACCACCATGCTCTCAGCCAAGG - Intronic
1160549064 18:79681380-79681402 CTCCACAATCCTCCCAGGTACGG - Intronic
1160700798 19:506468-506490 TTCCACCATCCTCCCAGCACAGG - Intergenic
1160897465 19:1409350-1409372 CTCCAGCCTCCTCACAGCCACGG - Intronic
1161447976 19:4328630-4328652 TCCCACCCTCCTCCCACCCAGGG + Intronic
1161468242 19:4443976-4443998 TACCTCCATCCACCCAGTCAGGG + Intronic
1161820649 19:6528995-6529017 TTGGCCCATCCTCCCAGCCCCGG + Intergenic
1162385660 19:10359208-10359230 CACCACCATCTTCCAAGCCATGG + Exonic
1162402245 19:10453303-10453325 TCCCACCAGCCCACCAGCCAAGG - Intronic
1163103184 19:15109582-15109604 TCACACCCTCCTCCCCGCCAGGG + Intronic
1163553969 19:17982371-17982393 CTCCCTCATCCTCCCTGCCAGGG + Intronic
1164157989 19:22608020-22608042 TGTCACCATCCTCCCAGCCGCGG - Intergenic
1164907302 19:31977822-31977844 TCCCGGCATCCTCCCAGCCAGGG + Intergenic
1165935577 19:39386644-39386666 AACCACCACCCTCCCTGCCATGG + Intronic
1166182098 19:41116369-41116391 TTCCACCATCACCCAAGCTAAGG - Intronic
1166213859 19:41323509-41323531 TGCCCCCATCCTCCCTGCCTGGG - Exonic
1166996007 19:46719999-46720021 ATCCCCCATCCTCCCAGACCTGG - Exonic
1167138693 19:47634267-47634289 TTCCTCCCTCATCCCAGCCATGG - Intronic
1167607972 19:50491585-50491607 TTCTCCCATCCTCCCCTCCATGG - Intergenic
1167658797 19:50783546-50783568 TTCCTCCCTCCTCCCTGCCTGGG - Intergenic
927117044 2:19915946-19915968 TTCGTCCATCTTGCCAGCCAAGG - Intronic
928090740 2:28373227-28373249 TAACACCATCCTCCAACCCATGG - Intergenic
928291010 2:30037412-30037434 GGCCACCATCATTCCAGCCATGG + Intergenic
928917691 2:36490709-36490731 TTCCTGCATCCTCCCACCTAGGG + Intronic
929481441 2:42312270-42312292 CCCCACCATCGTCCCTGCCAGGG + Intronic
929811314 2:45191276-45191298 TTCCACAGGCCTGCCAGCCAGGG + Intergenic
929922666 2:46183700-46183722 TTCCATCCTTCTCCCTGCCAAGG + Intronic
930189188 2:48440767-48440789 CTCCACCTTCCTCCCACCCCGGG + Intronic
930350422 2:50246755-50246777 TTCCACATTCATTCCAGCCAAGG + Intronic
931931742 2:67145524-67145546 TTTCTCCCTCCTCCCAGCCCTGG + Intergenic
932434524 2:71695272-71695294 CTCCTCCCTCCTCCCATCCATGG - Intergenic
933261451 2:80135887-80135909 TACCACCATCCTCCTACCCCTGG - Intronic
933950754 2:87327204-87327226 TTCCCCCACCCTCCCGGCCCAGG + Intergenic
935085183 2:99837974-99837996 TTCCACCGTCCTCAAAGCCTTGG + Intronic
935669409 2:105542441-105542463 TTCCACCACCCTCCAAGCACAGG - Intergenic
936329022 2:111531374-111531396 TTCCCCCACCCTCCCGGCCCAGG - Intergenic
936612203 2:114012288-114012310 TTCCTCCATCCTGCCAGGGATGG - Intergenic
937897932 2:126992502-126992524 ATCCATCATCTTCCCAGCCCAGG + Intergenic
937992167 2:127670462-127670484 TTTCCCCCTCCTCCCAGCCCTGG - Intronic
938359413 2:130676334-130676356 TTCCAACCCCCTCCCATCCATGG - Intergenic
939936366 2:148298309-148298331 TTCTCCCCACCTCCCAGCCAAGG - Intronic
940297207 2:152139664-152139686 TTTCTCCTTCCTCCCACCCAAGG + Intronic
940807311 2:158202513-158202535 TTCCACCATCCTGCTAGACCTGG + Intronic
942114807 2:172717772-172717794 TTCCACTCTCCTCCTACCCAAGG + Intergenic
944550999 2:200844737-200844759 CTCCTCCATCCTCCTACCCAGGG + Intergenic
947338367 2:229110745-229110767 TACCACCAACATCCCAGCCAAGG - Intronic
948429797 2:237912135-237912157 TTCCACCCTTCTCCCAGTGATGG - Intergenic
948781143 2:240322684-240322706 TTCCACCGTCCTCCCAGCTGGGG - Intergenic
948894811 2:240923153-240923175 CTCTGCCATCCTCCCTGCCACGG + Intronic
1170590178 20:17765721-17765743 TCCCACCACCCTCCCCTCCACGG + Intergenic
1170771943 20:19340575-19340597 TTCCACCATCCCCACAGCCTGGG + Intronic
1171854851 20:30334669-30334691 CTCCCCTCTCCTCCCAGCCAAGG - Intergenic
1173168928 20:40706676-40706698 TTCAACCAGCATCTCAGCCAGGG - Intergenic
1173704315 20:45098766-45098788 CTCCTCCATCCAACCAGCCAAGG + Intronic
1174052228 20:47774787-47774809 TGCCCCCATCCTCTCTGCCAAGG + Intronic
1174553553 20:51378465-51378487 TTCCCCACGCCTCCCAGCCAAGG - Intergenic
1174597125 20:51693092-51693114 TGCGGCCATCCTCTCAGCCAGGG + Intronic
1174710992 20:52705413-52705435 TCCCACCACCCTCTCAGCTAAGG + Intergenic
1174756246 20:53161317-53161339 GTTCACCCTCCTCCCACCCATGG - Intronic
1174890516 20:54387032-54387054 GTCCACCATGCTCCCATCTATGG - Intergenic
1175540456 20:59744549-59744571 CTCCACCATCCTCAAAGCCCTGG - Intronic
1178845052 21:36167705-36167727 TTCCTCCCTCCCCCCAGCCCCGG + Intronic
1179146536 21:38773344-38773366 TTGCCCCTTCCTCCAAGCCAAGG + Intergenic
1179320986 21:40291099-40291121 TTCCACTATCCTCACTGCCTGGG + Intronic
1179607718 21:42528232-42528254 CACCACTATCCTCCCAGCCCTGG - Intronic
1180059002 21:45375159-45375181 ACCCACCAGCCTCCCAGTCATGG - Intergenic
1180247833 21:46560364-46560386 TTCCACCATGCTGTCAGGCAGGG - Intronic
1180483574 22:15776277-15776299 GTGCACCACCCTCCCAGCCTAGG + Intergenic
1180978886 22:19869363-19869385 TGCCACCACCCTCCCTGCCAAGG - Intergenic
1181079295 22:20403347-20403369 TTCCACCATCCACCCAGGCTTGG + Intronic
1181409991 22:22712108-22712130 TTCCACGACCAACCCAGCCAAGG + Intergenic
1181964850 22:26649321-26649343 CTCTGCCTTCCTCCCAGCCAGGG - Intergenic
1183295246 22:37025367-37025389 TTCCACCATCCTCAGGGGCATGG - Intronic
1183658412 22:39204379-39204401 TCCCACCATCCCCGCAGCCATGG + Intergenic
1183949001 22:41342364-41342386 TTCCTCCACCCTCCCAGCCAGGG - Intronic
1184050898 22:42003884-42003906 TTTCACCATTCTTCCACCCAAGG - Intronic
1184283005 22:43449614-43449636 TTCCACCTGCCACCCAGCGAGGG + Intronic
1184349991 22:43937165-43937187 TCCCTCCAGCCTCACAGCCAAGG - Exonic
1184380565 22:44142709-44142731 TTCCACAGTCCTCCCACCCCTGG - Intronic
1185264340 22:49891603-49891625 TTTCACCATTCTTCCACCCAAGG + Intergenic
950301224 3:11880959-11880981 TGCCACCATGATGCCAGCCATGG - Intergenic
954581202 3:51703821-51703843 TGTCACCGTCATCCCAGCCACGG - Exonic
957322791 3:78653692-78653714 TTTAACCTTCCTCCCAGTCAAGG + Intronic
957375500 3:79351880-79351902 TTAAATCATCTTCCCAGCCATGG - Intronic
957686044 3:83503951-83503973 GTCCACCTTCCTGGCAGCCAAGG - Intergenic
960177169 3:114531687-114531709 TTCGGCCATCTTGCCAGCCAGGG - Intronic
960270069 3:115663827-115663849 TTCCTCAAGCCTCCCAGGCAAGG - Exonic
961424975 3:126837982-126838004 TTCCCTCATTCTCCCAGCCATGG + Intronic
961659389 3:128460438-128460460 GTCCACAACCCTCCCAGACAGGG - Intergenic
961667501 3:128502872-128502894 CTCCACCATCATCCCAGCCTTGG - Intergenic
964452659 3:156826584-156826606 GTCCGCCTTCCTCCCAGCCCCGG + Exonic
967222090 3:187256029-187256051 CTCCCCCATTATCCCAGCCATGG + Intronic
967261623 3:187648475-187648497 TTCCACCATCTTCAAAGCCAGGG + Intergenic
968221241 3:196941950-196941972 TAACACCATCCTCCCAGAGAAGG + Intronic
968585106 4:1412667-1412689 TCCCACCAGCCGCTCAGCCATGG - Intergenic
969479112 4:7437729-7437751 ATCCAACATCATCCCCGCCATGG - Intronic
969764120 4:9214871-9214893 TGCCATCATCCTCTCAGCGACGG - Intergenic
969764727 4:9219618-9219640 TGCCATCATCCTCTCAGCGACGG - Intergenic
969765331 4:9224365-9224387 TGCCATCATCCTCTCAGCGACGG - Intergenic
969765944 4:9229110-9229132 TGCCATCATCCTCTCAGCGACGG - Intergenic
969766553 4:9233853-9233875 TGCCATCATCCTCTCAGCGACGG - Intergenic
969767774 4:9243344-9243366 TGCCATCATCCTCTCAGCGACGG - Intronic
969768380 4:9248093-9248115 TGCCATCATCCTCTCAGCGACGG - Intronic
969768984 4:9252843-9252865 TGCCATCATCCTCTCAGCGACGG - Intronic
969769592 4:9257592-9257614 TGCCATCATCCTCTCAGCGACGG - Intronic
969770205 4:9262338-9262360 TGCCATCATCCTCTCAGCGACGG - Intronic
969770814 4:9267087-9267109 TGCCATCATCCTCTCAGCGACGG - Intronic
969771426 4:9271832-9271854 TGCCATCATCCTCTCAGCGACGG - Intronic
969771795 4:9324634-9324656 TGCCATCATCCTCTCAGCGAAGG - Intronic
969772408 4:9329379-9329401 TGCCATCATCCTCTCAGCGAAGG - Intronic
969773024 4:9334125-9334147 TGCCATCATCCTCTCAGCGAAGG - Intronic
969773641 4:9338872-9338894 TGCCATCATCCTCTCAGCGAAGG - Intronic
969774256 4:9343617-9343639 TGCCATCATCCTCTCAGCGAAGG - Intronic
969774871 4:9348362-9348384 TGCCATCATCCTCTCAGCGAAGG - Intronic
969775487 4:9353107-9353129 TGCCATCATCCTCTCAGCGAAGG - Intronic
969776101 4:9357852-9357874 TGCCATCATCCTCTCAGCGAAGG - Intronic
969776712 4:9362597-9362619 TGCCATCATCCTCTCAGCGAAGG - Intronic
969777330 4:9367343-9367365 TGCCATCATCCTCTCAGCGAAGG - Intergenic
969954958 4:10879713-10879735 TACCACCATCCTCCCATTCAGGG - Intergenic
972090294 4:35273111-35273133 TTCCACTAACCTCCCAGTGAGGG - Intergenic
974271386 4:59655864-59655886 ATCCACTCTCCCCCCAGCCAAGG + Intergenic
977876011 4:102150852-102150874 TTGCAGTATACTCCCAGCCAGGG + Intergenic
978207579 4:106096672-106096694 CTCCACCATCCTGTCAGTCATGG - Intronic
980700325 4:136418904-136418926 TCCCACCATCTCCTCAGCCAAGG + Intergenic
982108548 4:152032446-152032468 ATTCACCATCCTCACTGCCATGG - Intergenic
982524651 4:156462626-156462648 TTCAACCATCCTTGCATCCATGG + Intergenic
983302688 4:165947361-165947383 TTCCTCCATGACCCCAGCCAAGG - Intronic
983501212 4:168501776-168501798 TTTCACCACCCTCCCCGCCAAGG + Intronic
986749815 5:10776835-10776857 TCCCACCAGCCTCCCAGTCCAGG + Intergenic
987335064 5:16891451-16891473 TTCTCCCCTCCTCCCAGCCCCGG - Intronic
989154291 5:38329605-38329627 TACCCCCATCCACCCAGCCATGG + Intronic
990261445 5:54027577-54027599 TTCCACCAACCTCACAATCATGG + Intronic
990295684 5:54399124-54399146 CTCCACCCTCCTCCCTGCCCAGG - Intergenic
991619031 5:68526053-68526075 TGCCACCATCCACACTGCCATGG - Intergenic
992459106 5:76943775-76943797 TGACCCCATGCTCCCAGCCAGGG + Intergenic
992748749 5:79843035-79843057 TCCCTCCCTCCTTCCAGCCAAGG + Intergenic
995485246 5:112633627-112633649 TGCCACCATCCTCCTGGGCAGGG + Intergenic
995695629 5:114875892-114875914 TTCGGCCATCTTGCCAGCCAGGG - Intergenic
996372311 5:122766585-122766607 TTCCTCCTTCCTTACAGCCAGGG - Intergenic
999276050 5:150330852-150330874 TTCCTCCAACCTCACAGCCAAGG - Intronic
1000991757 5:167918396-167918418 TCCCACCGTCCTCCCAGACGAGG - Intronic
1001499144 5:172215244-172215266 TTGCACCCTCCTCCAACCCAGGG - Intronic
1001557309 5:172645534-172645556 TGTCACCCTCCTTCCAGCCATGG + Intronic
1001780710 5:174366596-174366618 TTCCACCATTCTACCACCTAGGG - Intergenic
1002020408 5:176361083-176361105 TTCAGCCATCCTCCCAGTCCAGG + Intronic
1002568448 5:180127288-180127310 CTCCACCCTCCTCCCTGCCCAGG + Intronic
1002810140 6:620741-620763 TTCTTCCCTCTTCCCAGCCAAGG + Intronic
1003927264 6:10887832-10887854 TGGCGCCATCTTCCCAGCCATGG + Intronic
1004330977 6:14720800-14720822 TTCCATCATCTTCCCAACCTTGG - Intergenic
1006763893 6:36487802-36487824 TTCCATTATCCTTCCTGCCAAGG - Exonic
1007462684 6:42029951-42029973 TTCAACCATTCTCCCACCAAGGG + Intronic
1007665914 6:43512873-43512895 CTCCACCATCCTCCTTCCCAGGG - Exonic
1009715537 6:67388655-67388677 TTGAACCATCCTTCCATCCAAGG - Intergenic
1010711226 6:79176940-79176962 TTCATCCATTCACCCAGCCATGG - Intergenic
1011626722 6:89289216-89289238 TTCCTCTCTCCTCCCAGGCAAGG - Intronic
1012406769 6:98909765-98909787 TTCCTCCCTCCTCCCAGTAAAGG + Intronic
1014129166 6:117811220-117811242 TTCACCCACCCCCCCAGCCAAGG - Intergenic
1015557872 6:134481798-134481820 TTCCATCCACCTCCCAGGCATGG - Intergenic
1016028541 6:139313823-139313845 ATGAACCATCCTCCCAGCCAAGG + Intergenic
1017655355 6:156622482-156622504 CTCCACCCTCCTCCCAGCTCTGG - Intergenic
1018092503 6:160357097-160357119 TTCCACTATGCTCACAGTCAAGG - Intronic
1018551613 6:165004590-165004612 TTCTACCTTCCTCCCCGCTAGGG + Intergenic
1018551820 6:165006901-165006923 TTCTACCTTCCTCCCCGCTAGGG + Intergenic
1019511352 7:1419197-1419219 TTCCACACTGCTCCCAGCCCTGG + Intergenic
1020677863 7:11201988-11202010 TACCCCCATCCTCCCAAACAGGG + Intergenic
1021028092 7:15694342-15694364 TTCCTCCATCTTCAGAGCCAGGG + Intergenic
1024906111 7:54382472-54382494 GTCCACAATGCTCTCAGCCAGGG + Intergenic
1026505727 7:70980873-70980895 TTCCTTAATTCTCCCAGCCAGGG - Intergenic
1027244491 7:76358351-76358373 TTCCCCCCTCCTCCTAGCCTGGG - Intronic
1029507555 7:100971480-100971502 TTCCACCATCCTCCCAGCCAGGG + Intronic
1029613010 7:101637304-101637326 GTCCACCATCCTCCCTGCTGTGG - Intergenic
1030547507 7:110915448-110915470 TTCCCCCACCCTCCCAGCCCTGG - Intronic
1032018623 7:128394594-128394616 TTCCACCCTCCACGCAGCGAGGG - Exonic
1034458674 7:151186315-151186337 TTCCCCCATCCTCCCTGAGAAGG + Intronic
1035368229 7:158362062-158362084 TACCATCAACCTCCCAGCCTGGG + Intronic
1035600106 8:892308-892330 TTCACCCATCCTCCCATCCATGG - Intergenic
1035727715 8:1834959-1834981 TTCCTCCATCCTCCCACCTGGGG - Intronic
1036030974 8:4972530-4972552 TTCCTGAAGCCTCCCAGCCATGG + Intronic
1036401616 8:8413794-8413816 TTCCACCATCTTCCCTTCCATGG - Intergenic
1036842420 8:12134531-12134553 TACCATCATCCTCTCAGCGATGG + Intergenic
1036863701 8:12376034-12376056 TACCATCATCCTCTCAGCGATGG + Intergenic
1036864259 8:12380746-12380768 TACCATCATCCTCTCAGCGACGG + Intergenic
1037718298 8:21418659-21418681 TTCCACCTTCCTCCCACTAATGG - Intergenic
1038392278 8:27213515-27213537 TTCCACTCTTCTCTCAGCCAGGG + Intergenic
1038738328 8:30192765-30192787 TTCAACTATCCACCCATCCATGG + Intergenic
1040806970 8:51405877-51405899 TTCAAACATTCTCCCAGGCAAGG + Intronic
1040889360 8:52300189-52300211 TTCCACCATGCTGCCAAACACGG + Intronic
1041074904 8:54160617-54160639 TTCCACAATTCTCTCAGGCAGGG - Intergenic
1042843602 8:73148627-73148649 TACCACCATCCACCAAGCCCTGG - Intergenic
1043968449 8:86505079-86505101 TTCCACCTCCCTCCCAGCATGGG + Intronic
1046550740 8:115712897-115712919 TCCCAGCATTCTCCCAGCAAAGG + Intronic
1048323944 8:133424422-133424444 TTCCCTCTTCCTTCCAGCCATGG + Intergenic
1049023900 8:139975608-139975630 TTCCCTCAACCTGCCAGCCAAGG + Intronic
1049337034 8:142092128-142092150 TGCCCCCATCCTCCTAGCCCAGG + Intergenic
1049357176 8:142194657-142194679 GTCCATCATCCTCCCCGTCATGG - Intergenic
1049578862 8:143401753-143401775 TCCAACCCTCCTCCCAGCCCTGG - Intergenic
1050412996 9:5385681-5385703 TTCCACCATCCTCTCTGTCTTGG - Intronic
1050630077 9:7549488-7549510 TGCCACCCTTCCCCCAGCCAGGG - Intergenic
1051946902 9:22580473-22580495 CTCCACCAGCTCCCCAGCCATGG - Intergenic
1052492656 9:29188840-29188862 CGCCACCTTCCTCCCAGACAGGG + Intergenic
1052973919 9:34398438-34398460 TCCCTCCAACCTCCCAGACAGGG + Exonic
1053072850 9:35111349-35111371 TTCCCCGGTCCTCCCTGCCACGG + Exonic
1053488658 9:38482735-38482757 TTCCAACTCCCTCCCAACCAAGG - Intergenic
1053792675 9:41697952-41697974 CTCCCCTCTCCTCCCAGCCAAGG - Intergenic
1054152505 9:61616868-61616890 CTCCCCTCTCCTCCCAGCCAAGG + Intergenic
1054181088 9:61909973-61909995 CTCCCCTCTCCTCCCAGCCAAGG - Intergenic
1054472275 9:65548016-65548038 CTCCCCTCTCCTCCCAGCCAAGG + Intergenic
1054656503 9:67671169-67671191 CTCCCCTCTCCTCCCAGCCAAGG + Intergenic
1055153028 9:73025822-73025844 TTTCACCATCCTCCCACCCCAGG - Intronic
1055946882 9:81699770-81699792 TTACACCCTACTCCCAGCCTTGG - Intergenic
1057032170 9:91784177-91784199 TTCCACCCTGCTCCCAGCTAAGG + Intronic
1057178183 9:93014368-93014390 TTCCCCCTCCCTCCCGGCCAGGG - Intronic
1057295157 9:93830400-93830422 TGCCACCAACTGCCCAGCCAGGG + Intergenic
1058426541 9:104880176-104880198 TTCAAGGATCCTCCCAGCCCTGG + Intronic
1059512754 9:114864744-114864766 TTCCTCCATCTTCCCAGCCCCGG + Intergenic
1061550844 9:131333925-131333947 TTGCACCCTCTTCCCAGCCCAGG - Intergenic
1062027687 9:134348002-134348024 CTCCTCCATCCCCACAGCCATGG - Intronic
1186611328 X:11140547-11140569 CTCCACCATCCTCAGAGCCCCGG - Intronic
1190894034 X:54597908-54597930 CTCCACCATCCCCCCAGCAGTGG - Intergenic
1191659680 X:63636536-63636558 TTCCAACATCCTCTCATCCCAGG - Exonic
1192185654 X:68945177-68945199 TGCCACCAGCCTCTGAGCCAGGG + Intergenic
1193073563 X:77332455-77332477 TTCCACCAAGCTCCCTCCCAGGG + Intergenic
1197392785 X:125888701-125888723 TTCAACCATCCTTCCATCCCAGG + Intergenic
1197708186 X:129648678-129648700 TTCCTCCGACCTCCCTGCCAGGG + Exonic
1197842631 X:130765318-130765340 TCCCTCCCTCCTCCTAGCCAAGG + Intronic
1198127479 X:133660352-133660374 TGCCACAGTCCTCCCACCCATGG + Intronic
1199976949 X:152899741-152899763 TTCCCTGATCTTCCCAGCCAGGG - Intergenic
1200968968 Y:9129727-9129749 TTCCACCATCTTCACAGCTGAGG + Intergenic
1201789242 Y:17819997-17820019 TTACACCAACTCCCCAGCCAGGG - Intergenic
1201812311 Y:18085990-18086012 TTACACCAACTCCCCAGCCAGGG + Intergenic
1202141857 Y:21732774-21732796 TTCCACCATCTTCACAGCTGAGG - Intergenic
1202145008 Y:21771028-21771050 TTCCACCATCTTCACAGCTGAGG + Intergenic