ID: 1029507558

View in Genome Browser
Species Human (GRCh38)
Location 7:100971487-100971509
Sequence ATCCTCCCAGCCAGGGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029507550_1029507558 9 Left 1029507550 7:100971455-100971477 CCTTCGAGGTAACCCACCAGGGA 0: 1
1: 0
2: 0
3: 9
4: 60
Right 1029507558 7:100971487-100971509 ATCCTCCCAGCCAGGGACTCAGG No data
1029507546_1029507558 21 Left 1029507546 7:100971443-100971465 CCCTGCAGGACACCTTCGAGGTA 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1029507558 7:100971487-100971509 ATCCTCCCAGCCAGGGACTCAGG No data
1029507547_1029507558 20 Left 1029507547 7:100971444-100971466 CCTGCAGGACACCTTCGAGGTAA 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1029507558 7:100971487-100971509 ATCCTCCCAGCCAGGGACTCAGG No data
1029507551_1029507558 -3 Left 1029507551 7:100971467-100971489 CCCACCAGGGAAGTTCCACCATC 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1029507558 7:100971487-100971509 ATCCTCCCAGCCAGGGACTCAGG No data
1029507552_1029507558 -4 Left 1029507552 7:100971468-100971490 CCACCAGGGAAGTTCCACCATCC 0: 1
1: 0
2: 0
3: 23
4: 167
Right 1029507558 7:100971487-100971509 ATCCTCCCAGCCAGGGACTCAGG No data
1029507553_1029507558 -7 Left 1029507553 7:100971471-100971493 CCAGGGAAGTTCCACCATCCTCC 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1029507558 7:100971487-100971509 ATCCTCCCAGCCAGGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029507558 Original CRISPR ATCCTCCCAGCCAGGGACTC AGG Intronic
No off target data available for this crispr