ID: 1029508960

View in Genome Browser
Species Human (GRCh38)
Location 7:100981353-100981375
Sequence CACTCGCTGCAGGAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 253}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029508960_1029508969 12 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508969 7:100981388-100981410 TTGGTGGAGTTTGCTAGCCCAGG 0: 1
1: 0
2: 2
3: 7
4: 75
1029508960_1029508974 23 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508974 7:100981399-100981421 TGCTAGCCCAGGGGACGACGGGG 0: 1
1: 0
2: 0
3: 7
4: 54
1029508960_1029508975 27 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508975 7:100981403-100981425 AGCCCAGGGGACGACGGGGATGG 0: 1
1: 0
2: 1
3: 12
4: 266
1029508960_1029508973 22 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508973 7:100981398-100981420 TTGCTAGCCCAGGGGACGACGGG 0: 1
1: 0
2: 0
3: 2
4: 46
1029508960_1029508970 13 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508970 7:100981389-100981411 TGGTGGAGTTTGCTAGCCCAGGG 0: 1
1: 0
2: 1
3: 7
4: 104
1029508960_1029508967 -4 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508967 7:100981372-100981394 AGTGAAGAACCTGGGCTTGGTGG 0: 1
1: 1
2: 2
3: 32
4: 372
1029508960_1029508971 14 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508971 7:100981390-100981412 GGTGGAGTTTGCTAGCCCAGGGG 0: 1
1: 0
2: 2
3: 5
4: 127
1029508960_1029508966 -7 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508966 7:100981369-100981391 GCGAGTGAAGAACCTGGGCTTGG 0: 1
1: 0
2: 0
3: 15
4: 130
1029508960_1029508972 21 Left 1029508960 7:100981353-100981375 CCTTGTCCCTCCTGCAGCGAGTG 0: 1
1: 0
2: 3
3: 24
4: 253
Right 1029508972 7:100981397-100981419 TTTGCTAGCCCAGGGGACGACGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029508960 Original CRISPR CACTCGCTGCAGGAGGGACA AGG (reversed) Intronic
900101508 1:964065-964087 CACTCCCAGCAGGAGTGCCACGG + Intronic
900402531 1:2478413-2478435 CACTCCTCGCAGGAGAGACACGG - Intronic
900745461 1:4357625-4357647 CACTCCCTGCGAGGGGGACAAGG + Intergenic
902649148 1:17825461-17825483 CACTGGCTGCAGGAGCAACATGG - Intronic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
906525268 1:46489924-46489946 CAGTCGCTGCAGGGAGGACGCGG + Intergenic
907863897 1:58380186-58380208 CACATGTTGAAGGAGGGACATGG + Intronic
910321935 1:85955646-85955668 CACACCCTGCAGGGGGGATAAGG + Intronic
911587283 1:99705233-99705255 CACACCCTGCAAGGGGGACAAGG + Intergenic
912566668 1:110592486-110592508 CAGTCCCAGCAGGAGGGACCAGG + Intergenic
913392275 1:118327592-118327614 CACGTGCTGTAGGAGGGAGACGG + Intergenic
915051929 1:153084295-153084317 CTCTCACTGCAGCAGTGACAGGG - Intergenic
915716704 1:157951111-157951133 CACACTCTCCAGGAGGGACCAGG - Intergenic
915732130 1:158061192-158061214 TACTCCCAGCAAGAGGGACAGGG - Intronic
916508567 1:165450745-165450767 AACTCACTGCAGGCGGGGCAGGG - Intergenic
917554323 1:176067978-176068000 CACACCCTGCAAGGGGGACAAGG + Intronic
917599719 1:176562045-176562067 CACATGTTGCAGGAGGGACCTGG - Intronic
918177153 1:182056728-182056750 CACTTGCCGCAGGTGGGGCAGGG + Exonic
918343782 1:183589030-183589052 CTCTGGCTGGAGGAAGGACATGG - Intronic
919778122 1:201207144-201207166 GACTCACTGCAGGAGGCAGATGG + Exonic
920333423 1:205228267-205228289 CAGTCATTGCAGGAGGGAGAAGG - Exonic
920942293 1:210495054-210495076 CTCTCACTGCTGGAGAGACAGGG - Intronic
921092141 1:211854621-211854643 CACGCCCTGCAAGGGGGACAAGG - Intergenic
921116091 1:212093134-212093156 CACGCCCTGCAAGGGGGACAAGG - Intronic
923019128 1:230149263-230149285 CACCCGCTCCAGGAGAGACAAGG - Intronic
1063434921 10:6021887-6021909 CACCCCTTGCAGGAGTGACAGGG - Intronic
1063551210 10:7035369-7035391 CACGCGCCGCAGGAGGGACTAGG - Intergenic
1064234647 10:13563024-13563046 CACTTACTGCAGGAGGGGAAGGG + Intergenic
1064751060 10:18529480-18529502 CTGTTGCTGCAGGAGGCACAGGG + Intronic
1067155778 10:43780154-43780176 CACTGGCTGCAGGTGGGCCCAGG - Intergenic
1067842438 10:49691744-49691766 CAGGCCCTGCAGGAGGGCCAGGG + Intronic
1069778336 10:70939619-70939641 CAGTGGCTGCTGGAGGCACAGGG + Intergenic
1072144345 10:92620861-92620883 CACGCGTTGCGGGAGGGACCTGG - Intronic
1073208525 10:101781098-101781120 CAGTCTCTGCAGGTGGGAGAGGG - Intergenic
1073217028 10:101842108-101842130 CACTCCCCTCAGGAAGGACAAGG + Intronic
1075270127 10:121042258-121042280 TACTTGCTGCAGGAGGGAATGGG + Intergenic
1075377649 10:121992048-121992070 CACTTGTTGCAGGAAGGACCTGG - Intronic
1076049112 10:127318585-127318607 CTCTCACTGCAGGAGGCTCAGGG - Intronic
1076215967 10:128693608-128693630 CAGTAGCTGCAGCAGGGACAGGG - Intergenic
1076418221 10:130307692-130307714 GACCCACTGCAGGAGGGAAAGGG - Intergenic
1076676096 10:132148538-132148560 CACCAGCTGCAGCAGGGCCACGG - Intronic
1077257056 11:1590397-1590419 CCCTCGGTCCAGGAAGGACATGG - Intergenic
1078012448 11:7583099-7583121 CACTGGCTTCAGGAGTGACCAGG - Intronic
1079301093 11:19279543-19279565 CACTCACTGCAGAAGGGGAAGGG + Intergenic
1080523139 11:33085933-33085955 CAACAGCTGCAGGAGGGACTGGG + Exonic
1082886971 11:58095711-58095733 CACTCGCCATGGGAGGGACAAGG - Intronic
1083185709 11:61016699-61016721 CACTAGCTGCAAGAGAGGCAGGG + Intronic
1083341232 11:61959688-61959710 GACTGGCTGCAGGAGGGAGGAGG - Intronic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1084156266 11:67314466-67314488 CACAGGCTGCAGGAGGGGCAGGG - Intergenic
1084277250 11:68059917-68059939 CACACGCAGAAGGAGGGATAGGG - Intronic
1084512005 11:69611891-69611913 CCCTCGCGGCAAGAGGGACAGGG + Intergenic
1088507240 11:110538934-110538956 CACACCCTGCAAGGGGGACAAGG - Intergenic
1089181060 11:116583078-116583100 CACTAGTTGCAGGAGGCTCAGGG + Intergenic
1089677050 11:120097127-120097149 CCCTCGCAGCAGGAGGGGGAAGG + Intergenic
1091105778 11:132918400-132918422 CAGGTGCTGCAGGAGGTACAGGG - Intronic
1092593526 12:9974881-9974903 CACATGCTGTAGGAGGGACATGG + Intronic
1092766924 12:11861404-11861426 CACATGCTGCAGCAGGGGCAAGG - Intronic
1094005361 12:25743301-25743323 CACTTGCTGTAGGAGGCACGGGG - Intergenic
1095376088 12:41530866-41530888 CACTCTCTGCCAGAAGGACAAGG - Intronic
1098810528 12:75084410-75084432 CACGTGTTGCAGGAGGGACCAGG + Intronic
1099543235 12:83941649-83941671 CACTCACGGCAGAAGGGAGAGGG + Intergenic
1100641359 12:96484771-96484793 CACGCCCTGCAAGGGGGACAAGG + Intergenic
1101396562 12:104353933-104353955 CACGCGTTGCGGGAGGGACCTGG - Intergenic
1101646049 12:106631863-106631885 CAAGCCCTGCAGCAGGGACAGGG - Intronic
1101709810 12:107254744-107254766 GACTCGCTGCCAGAGAGACAAGG - Intergenic
1103516830 12:121513704-121513726 CACTCTCTGCAGGCAGGTCAGGG - Intronic
1104034542 12:125089309-125089331 CACCCACTGCAGGGGGGAGAAGG + Intronic
1104265840 12:127231812-127231834 CACTCTCTGCAGGTGGAACCTGG - Intergenic
1104498045 12:129259214-129259236 CACTCACTGCAGGAGGATCTAGG + Intronic
1106208720 13:27621701-27621723 CACTCGCGGCGGGAGGGGCAGGG - Exonic
1106340436 13:28821612-28821634 TACTGGGTGGAGGAGGGACAAGG - Intronic
1107878373 13:44810343-44810365 CACTTGCAGCAGTAGTGACAAGG - Intergenic
1108605114 13:52029866-52029888 CATTCGCTACATGAGGGACAAGG - Exonic
1108760182 13:53553307-53553329 CACATGCTGCAGGAGGAACTTGG + Intergenic
1113445344 13:110361914-110361936 CACTGACTTCAGGAGGGAAATGG + Intronic
1115469692 14:33755831-33755853 CACTCGTGGCAGAAGGGAAAGGG + Intronic
1116937562 14:50757862-50757884 CCCTTGCTGAAGCAGGGACAGGG + Exonic
1117416686 14:55502917-55502939 CACTGGCTGCAAGAGAGACTTGG - Intergenic
1118667385 14:68085798-68085820 CACGCCCTGCAAGGGGGACAAGG - Intronic
1118990950 14:70796573-70796595 CACTCGCTGGAGAGGAGACAGGG - Intronic
1119530244 14:75354977-75354999 CACTCCCTGCAGGAGGAGCTGGG - Intergenic
1119697552 14:76725848-76725870 CACGCCCTGCAAGGGGGACAAGG - Intergenic
1120294964 14:82628335-82628357 AGCTAGCTGCAGGAGTGACAAGG - Intergenic
1121684290 14:95821610-95821632 CACTTGATGAGGGAGGGACATGG + Intergenic
1122371087 14:101229408-101229430 CACGCCCTGCGAGAGGGACAAGG - Intergenic
1124578046 15:30926736-30926758 CACTCGCTGGAGGAGGAAGCAGG + Intronic
1124650413 15:31469706-31469728 CACTGGCTGCAGAAGGGAGGTGG - Intergenic
1130895646 15:88168633-88168655 CACTCCCTGCAGGAGGCAGTGGG - Intronic
1131876004 15:96807136-96807158 CACAGGCTGTAGGAGGGACCCGG + Intergenic
1133112109 16:3554235-3554257 CACTCACTGCAGCATGGAGAGGG + Exonic
1133120494 16:3603789-3603811 CATTGGCTGCAGGTGAGACAGGG - Intronic
1134134537 16:11670039-11670061 CACTGGCTGCTGGAGGCCCAGGG + Intronic
1134684593 16:16149889-16149911 CATTGGCTGCAGGGTGGACAGGG + Exonic
1135594286 16:23729859-23729881 CACTCACTGCAGCTGGGAAATGG - Intergenic
1136082173 16:27859417-27859439 CACTCGCCGGAGGATGGACTAGG - Intronic
1136924029 16:34354725-34354747 TACTGGCTGTAGGAAGGACATGG - Intergenic
1136980544 16:35057081-35057103 TACTGGCTGTAGGAAGGACATGG + Intergenic
1137037726 16:35580475-35580497 CTCTCACTGCAGCAGTGACATGG - Intergenic
1137317787 16:47345675-47345697 CACGGGCTGCAGGTTGGACAAGG + Intronic
1138590998 16:57999944-57999966 ACCTTGCTGCAGGAGGGCCAGGG - Intronic
1139968152 16:70756886-70756908 CACTCACTGCATGAAGAACATGG - Intronic
1140805981 16:78532824-78532846 CACATGTTGCAGGAGGGACCAGG - Intronic
1142084006 16:88166556-88166578 CAAGGGGTGCAGGAGGGACACGG - Intergenic
1143660611 17:8322370-8322392 CCCTGACTGCAGGAGGCACAGGG + Exonic
1145712415 17:26989799-26989821 CACTCGTGGCAGAAGGGAAAGGG - Intergenic
1145796814 17:27660430-27660452 CCCTCTCAGCAGGAAGGACAGGG + Intergenic
1145811206 17:27765418-27765440 CCCTCTCAGCAGGAAGGACAGGG + Intronic
1148089711 17:45016004-45016026 CAGTGGCTGCAGGAGGGGCTGGG - Intergenic
1148136292 17:45294022-45294044 CACACGCTGCAGGAGGGAGAAGG - Intronic
1150281266 17:63930881-63930903 CAGTCCCTGCAGGAGGGAAGAGG - Intronic
1151898946 17:76999040-76999062 CACTCCTGTCAGGAGGGACATGG - Intergenic
1152630863 17:81410182-81410204 CACGAGCTGCCGGAGGCACATGG + Intronic
1153641650 18:7162831-7162853 CAATCGCTGCAGCAGTGATAAGG - Intergenic
1153990416 18:10394364-10394386 CACACCCTGCAAGGGGGACAAGG - Intergenic
1154019199 18:10647832-10647854 CTCTTGCTGCAGCAGTGACAGGG - Intergenic
1154185017 18:12175392-12175414 CTCTTGCTGCAGCAGTGACAGGG + Intergenic
1154465162 18:14637280-14637302 CACCTCTTGCAGGAGGGACAAGG + Intergenic
1157003287 18:43552277-43552299 CACACTTGGCAGGAGGGACAGGG - Intergenic
1157251230 18:46098079-46098101 CGCTCTCTGCAGGAGGGCGAGGG - Intronic
1157414603 18:47491297-47491319 GACTTGGTGCAGGAGGCACAGGG + Intergenic
1158140472 18:54250214-54250236 CACGTGTTGCAGGAGGGACCTGG + Intergenic
1158956653 18:62546632-62546654 CTCTCTCAGCATGAGGGACAGGG - Intronic
1160408938 18:78661622-78661644 CTCTCACTGGAGGAGGGACAAGG - Intergenic
1160454998 18:78993657-78993679 CACTCGCTGGAGGCGGGCGAGGG - Exonic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1161060047 19:2210334-2210356 CTCTCGGTGCAGGAGGGCCGTGG + Intronic
1162011075 19:7815473-7815495 CACGCCCTGCAAGGGGGACAAGG - Intergenic
1164860518 19:31558795-31558817 CACTCGCTGCAGGCAGGCCAAGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926415589 2:12646500-12646522 CACACGTTGCGGGAGGGACCCGG - Intergenic
927822986 2:26285478-26285500 CACTGGCTGCAGGTTGGTCATGG + Exonic
927945212 2:27131503-27131525 CACTCCCTGCAGGAGGGAAAGGG + Exonic
928182184 2:29076139-29076161 CACTGTCTGCAGGAGGGAGAGGG + Intergenic
928535641 2:32238408-32238430 AAGTCGCTGCAGGAAGAACATGG - Intronic
928884399 2:36131602-36131624 TTCTAGCTGCTGGAGGGACAAGG - Intergenic
929628580 2:43435067-43435089 CACACCCTGCAAGGGGGACAAGG + Intronic
931206146 2:60147712-60147734 GACTGGCTGCAGGTGGAACATGG + Intergenic
933688273 2:85160001-85160023 CACTGGCTGGAGATGGGACATGG - Intronic
934716758 2:96549229-96549251 CACTGGCTGCAGGAGGAATAAGG - Intronic
934736247 2:96691334-96691356 CACCAGCTGCAGGAAGGAGAGGG - Intergenic
936614369 2:114033530-114033552 CACTTGCTGCAGGTGGAATAAGG + Intergenic
937873619 2:126804018-126804040 CACACCCTGCAAGAGGGACAAGG - Intergenic
937969119 2:127536091-127536113 AACTCCCTGCAGGAGGGGAACGG + Intronic
939201771 2:139044606-139044628 CACTTGCTGTGGGAGGGACCCGG + Intergenic
943063999 2:183068669-183068691 TGCTGGCTGCAGGAGGGATAGGG + Intergenic
944667161 2:201967864-201967886 CACAGCCTGCAGCAGGGACAAGG - Intergenic
946305986 2:218857363-218857385 GACTGAGTGCAGGAGGGACAAGG + Intergenic
946892740 2:224295152-224295174 CATTTGCTGTAGGAGGGACCTGG + Intergenic
947323669 2:228951010-228951032 AAGTCACTGCAGAAGGGACAAGG - Intronic
947740101 2:232481045-232481067 CCCCTGCTGCAGGAGGGACGGGG - Intronic
948075355 2:235161491-235161513 CACTTGGTGCAGGAGTCACAGGG + Intergenic
948088143 2:235267630-235267652 CACTAGCTACAGGAGGAGCAGGG - Intergenic
948283846 2:236769169-236769191 AAGTTCCTGCAGGAGGGACATGG + Intergenic
1169029511 20:2396704-2396726 CACTCTTCTCAGGAGGGACAAGG + Intronic
1170844672 20:19952307-19952329 CACTCGCAGCAGATGGGGCATGG + Intronic
1171135626 20:22692148-22692170 CGCTGCTTGCAGGAGGGACAGGG - Intergenic
1171564128 20:26162910-26162932 CATGCCCTGCAAGAGGGACAAGG - Intergenic
1172610122 20:36244557-36244579 CAGGCTCTGCAGGAGTGACAAGG + Intronic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1175717934 20:61267980-61268002 CACAGGCTGCAAGAGGGACACGG - Intronic
1176809376 21:13521106-13521128 CACCTCTTGCAGGAGGGACAAGG - Intergenic
1176983704 21:15411893-15411915 CACATGTTGCAGGAGGGACCAGG + Intergenic
1176993381 21:15524209-15524231 CACACCCTGCAAGGGGGACAAGG + Intergenic
1179265877 21:39802967-39802989 CACACGTTGTGGGAGGGACATGG - Intergenic
1179466651 21:41580278-41580300 CAGCAGCTGGAGGAGGGACAGGG + Intergenic
1179782349 21:43709772-43709794 CACTGGGTGCTGGCGGGACATGG - Intergenic
1179983951 21:44910886-44910908 CACCCCCTGCAGCAGGGACAGGG - Intronic
1180928326 22:19571438-19571460 CACCCCTTGGAGGAGGGACAGGG + Intergenic
1181094406 22:20495785-20495807 CACTCGCAGCTGGAGGGAGGCGG + Exonic
1181670131 22:24422081-24422103 CACTCACTGCAGGGAGGAGAGGG - Intronic
1182361314 22:29748067-29748089 CTCTCGGAGCAGGAGGGAGAGGG - Intronic
1182739603 22:32558169-32558191 CACTTGCTCCAGGAAGGAGAGGG - Intronic
1183360125 22:37378997-37379019 CACACACAGCAGGGGGGACAGGG + Intronic
1184805705 22:46793715-46793737 CCCACGCTGCAGGAGGGGCCAGG + Exonic
1185122039 22:48977142-48977164 CACTCCCTGCTGGAGGGAACAGG - Intergenic
1185388287 22:50546558-50546580 CCGGCGCTGCAGCAGGGACAGGG - Intergenic
949577096 3:5349019-5349041 CACTCTCTGCTGGAGGGTGATGG + Intergenic
949818518 3:8089335-8089357 CACGTGCTGTAGGAGGGACCTGG + Intergenic
951969915 3:28432081-28432103 CACATGTTGTAGGAGGGACATGG - Intronic
952011848 3:28908730-28908752 CACTTGCTGAAGGAGGGTCCTGG + Intergenic
954099510 3:48358365-48358387 CACTGGCTGCAGCAGGGAGGTGG - Intergenic
954420403 3:50416125-50416147 CCCTGGCCGAAGGAGGGACAAGG - Intronic
954922276 3:54202210-54202232 CACTTGGTGCAGAAGGGACCTGG + Intronic
955480637 3:59385786-59385808 CACGCCCTGCAAGGGGGACAAGG + Intergenic
956674889 3:71724833-71724855 CTCTCCCTGCAGCAGGGACGCGG + Intronic
957040128 3:75329888-75329910 CACTCACTGCAGGAGGGCTTTGG + Intergenic
957442690 3:80270985-80271007 CACACGTTGTAGGAGGGACCCGG + Intergenic
959589221 3:108058424-108058446 CAATCGCTGGAGGAAGGAAAAGG + Exonic
961413419 3:126740228-126740250 CTGCAGCTGCAGGAGGGACAAGG - Intronic
962198062 3:133380254-133380276 CACCAGGTGCAGGCGGGACAGGG - Exonic
963602646 3:147391395-147391417 CGCTCTCTGCACGAGGGAAAGGG - Intronic
966217754 3:177520290-177520312 CACACCCTGCAAGAGGGACAAGG + Intergenic
968430656 4:556399-556421 CCCACGCAGCAGGAGGGAAAAGG + Intergenic
968916457 4:3499022-3499044 CACTCCCTGCAGCAGGGCTAGGG - Intronic
969854867 4:9991031-9991053 CACTCGCTGCAGGCAGCACTGGG - Intronic
971157801 4:24102153-24102175 CACCCACTGAAGGTGGGACAGGG - Intergenic
972575002 4:40343518-40343540 CACATGTTGCAGGAGGGACGTGG - Intronic
973641816 4:52910724-52910746 CACATGCAGCAGGAGGGACCTGG + Intronic
974479967 4:62430398-62430420 CTCTGGATCCAGGAGGGACAGGG + Intergenic
974752122 4:66154696-66154718 CACACACTGCGAGAGGGACAAGG + Intergenic
976319910 4:83702217-83702239 CACTTGCTGTGGGAGGGACCTGG - Intergenic
980100629 4:128538530-128538552 CACGCCCTGCAAGGGGGACAAGG - Intergenic
982268757 4:153565176-153565198 GAAGCTCTGCAGGAGGGACAGGG + Intronic
982795126 4:159635226-159635248 CACACGTTGTAGGAGGGACCTGG - Intergenic
983145900 4:164214875-164214897 CACGCCCTGCAAGGGGGACAAGG - Intronic
984539019 4:181013927-181013949 AACTCGCTACAGGAGGGAGCTGG + Intergenic
985377443 4:189355880-189355902 CACTCGCAGCCCGAGGGACCTGG - Intergenic
985474470 5:71652-71674 CACTTGCTCCAAAAGGGACATGG - Intergenic
985769295 5:1799164-1799186 CACTTGCAGCAGGCGGGAAAGGG - Intronic
988037718 5:25850127-25850149 CATTAGTTGCAGGATGGACAGGG - Intergenic
992357275 5:75999183-75999205 CACGTGTTGCAGGAGGGACCTGG - Intergenic
993478739 5:88396813-88396835 CACCCACCGCAGGAGGGCCAGGG - Intergenic
993973570 5:94449549-94449571 GACTCCCTGCATGAAGGACAAGG + Intronic
994886190 5:105564468-105564490 CACGCCCTGCAAGGGGGACAAGG + Intergenic
997273755 5:132564999-132565021 GACTTGTTGCAGGAGGGACCTGG + Intronic
997825911 5:137106712-137106734 CACTGGCTGCAGGGTGGGCATGG - Intronic
998527685 5:142857528-142857550 CCCTTGCTGCAGGAGGGACGAGG - Intronic
998568998 5:143240250-143240272 CATTTGCTGCAGGAGGGAGGTGG + Intergenic
998651457 5:144125708-144125730 CACGCCCTGCAGGAGCCACATGG - Intergenic
999370106 5:151049721-151049743 CACTGGCTGCAGGAGGGAGGAGG + Intronic
1001065602 5:168532816-168532838 CACTTGCGGCAGGAGGGGCAGGG - Intergenic
1001396799 5:171423560-171423582 GTGGCGCTGCAGGAGGGACAAGG - Intronic
1001598836 5:172915813-172915835 CAGAGGCTGCAGGAGGGACAAGG - Intronic
1001646442 5:173285285-173285307 CACGTGTTGCAGGAGGGACCTGG + Intergenic
1002688184 5:181031922-181031944 CACTCCCTGCAGGACACACAGGG - Intergenic
1003131286 6:3397152-3397174 CACACCCTGCAAGGGGGACAAGG + Intronic
1006013454 6:31061754-31061776 CACTGGCTGCAAGGGGGACCGGG - Intergenic
1006244344 6:32717357-32717379 CACTCCCTGCAAGGGGAACAAGG - Intergenic
1006273298 6:32980879-32980901 CATTTACTGAAGGAGGGACATGG + Exonic
1007249002 6:40482945-40482967 CAGTGGCTGCAGCAGGGACAGGG - Intronic
1012199110 6:96383529-96383551 TACTGGAAGCAGGAGGGACAAGG + Intergenic
1013220613 6:108074454-108074476 TCCACCCTGCAGGAGGGACAGGG + Exonic
1013296382 6:108761582-108761604 CACTAGCTGCAGGTGGGTCCTGG + Intergenic
1014088117 6:117371711-117371733 CACTGGCTGCATGGGAGACATGG + Intronic
1015394175 6:132716770-132716792 GACATGCTGGAGGAGGGACAAGG - Intergenic
1015729681 6:136335094-136335116 CACACCCTGCAAGGGGGACAAGG + Intergenic
1017707737 6:157139495-157139517 CACCCCCTGCAGGCGGGCCAGGG - Intronic
1018628577 6:165803860-165803882 TACTTGGTGTAGGAGGGACAAGG + Intronic
1021170527 7:17393752-17393774 CACACGTTGTAGGAGGGACCTGG - Intergenic
1021787015 7:24162651-24162673 CACTCGTTGAGGGAGGGACGTGG + Intergenic
1023054705 7:36282449-36282471 CACTCCCTGCGGGAGGGGCCAGG - Intronic
1025003785 7:55339840-55339862 CAATCGCTGTAGTAGGAACAGGG - Intergenic
1026577110 7:71581550-71581572 CACGCGTTGAAGGAGGGACCTGG - Intronic
1029171033 7:98629052-98629074 CACTCAATGCACAAGGGACATGG - Exonic
1029508960 7:100981353-100981375 CACTCGCTGCAGGAGGGACAAGG - Intronic
1031033031 7:116755371-116755393 CACCCCTTGAAGGAGGGACAAGG + Exonic
1031480014 7:122267084-122267106 CACATGTTGCAGGAGGGACCAGG + Intergenic
1034163349 7:149007962-149007984 CTCTCTTTGCCGGAGGGACAGGG - Intronic
1036792421 8:11730254-11730276 TCTTCGCTGCAGGAGTGACAGGG + Intronic
1039150731 8:34502434-34502456 CACATGCTGTAGGAGGGACCCGG - Intergenic
1042872049 8:73408285-73408307 GCCTGGCTGCAGGAGGGCCATGG - Intergenic
1043605218 8:81991357-81991379 CACACCCTGCAAGGGGGACAAGG - Intergenic
1044442233 8:92236462-92236484 CACTTGTTGTAGGAGGGACCTGG - Intergenic
1046590268 8:116198128-116198150 CACACCCTGCAAGGGGGACAAGG - Intergenic
1049610680 8:143553422-143553444 CACACGCAGCAGAAGGGACGTGG + Exonic
1049706793 8:144046829-144046851 CACACGCTGCAGGAAGTCCACGG - Exonic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1053473149 9:38361048-38361070 CAGTCCCAGCAGGAGGCACAAGG + Intergenic
1054896042 9:70312402-70312424 CACTTGCTGAGGGAGGGACCTGG - Intronic
1054920599 9:70539105-70539127 CACTTGCTGCAGGAAGACCATGG + Intronic
1055526444 9:77138478-77138500 CACTCACGGCAGGAGGAACCAGG + Intergenic
1057420161 9:94905855-94905877 CACTCCCTGCAGAAATGACAGGG - Intronic
1059438240 9:114289062-114289084 CCCTCCCTGCAGGAGGGTCTGGG + Intronic
1061942483 9:133891246-133891268 CACTCTCAGCAGGAGGGATGGGG + Intronic
1062565753 9:137163315-137163337 CACTCACTTGAGGATGGACAGGG - Exonic
1185829280 X:3284154-3284176 GACTCTCTGCAGGAGGATCAAGG + Exonic
1186433310 X:9522769-9522791 CAACCGAGGCAGGAGGGACAAGG - Intronic
1187138590 X:16571513-16571535 CACACCCTGCAAGGGGGACAAGG + Intergenic
1187619279 X:21031899-21031921 CACGTGTTGCAGGAGGGACCTGG - Intergenic
1192618458 X:72652329-72652351 CCCGGGCAGCAGGAGGGACATGG + Intronic
1193358375 X:80550815-80550837 CACACCCTGCAGAGGGGACAAGG - Intergenic
1193580786 X:83260215-83260237 CACTCGCTGCAGCAGGGGCAAGG - Intergenic
1193593533 X:83419338-83419360 CTCTCGCTGCAGCAGTGGCAGGG - Intergenic
1194068210 X:89288037-89288059 CACACCCTGCAAGAGGGACAAGG - Intergenic
1194974368 X:100378790-100378812 CACTCCCTGCAGCTGGGCCATGG + Intronic
1195883575 X:109617985-109618007 CAATAGCTGGAGGAGGGAGAAGG + Intergenic
1196006755 X:110844598-110844620 CACGCCCTGCAAGAGGGATAAGG + Intergenic
1198439809 X:136652174-136652196 CACCTGCTGCAGTAGAGACAAGG - Intronic
1199203093 X:145116358-145116380 CACATGTTGCAGGAGGGACCCGG - Intergenic
1200722352 Y:6622207-6622229 CACACCCTGCAAGAGGGACAAGG - Intergenic