ID: 1029511878

View in Genome Browser
Species Human (GRCh38)
Location 7:101000745-101000767
Sequence CTGAGGTTGTGGAGCTGTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 4, 1: 1, 2: 11, 3: 20, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029511878_1029511888 26 Left 1029511878 7:101000745-101000767 CCCTGACAGCTCCACAACCTCAG 0: 4
1: 1
2: 11
3: 20
4: 245
Right 1029511888 7:101000794-101000816 CACAGCAGCCAAGACGCAACGGG 0: 4
1: 0
2: 1
3: 19
4: 121
1029511878_1029511887 25 Left 1029511878 7:101000745-101000767 CCCTGACAGCTCCACAACCTCAG 0: 4
1: 1
2: 11
3: 20
4: 245
Right 1029511887 7:101000793-101000815 CCACAGCAGCCAAGACGCAACGG 0: 3
1: 1
2: 2
3: 22
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029511878 Original CRISPR CTGAGGTTGTGGAGCTGTCA GGG (reversed) Exonic
900501609 1:3008362-3008384 ATGAGATTGTGGAGGGGTCAGGG + Intergenic
900515386 1:3079404-3079426 CTGCGGTTGCAGGGCTGTCAGGG + Intronic
900551387 1:3257941-3257963 CTGTGGGTGGGGAGCTGTCCTGG + Intronic
900691527 1:3983366-3983388 CTGAGCTGGGGGAGCTGTCTGGG + Intergenic
902216057 1:14935155-14935177 CTTGGGTTCTGGAGCAGTCACGG + Intronic
902610585 1:17594909-17594931 CAAAGGGTGTGGAGCTGTCTGGG + Intronic
903184484 1:21621700-21621722 CTGAGGTTGTGTGGCTGACCTGG - Intronic
903668788 1:25023313-25023335 CTGAGGTTTTGGAGGAATCAGGG - Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904078683 1:27858467-27858489 CTGAGGTTTTGGAGCAGGGACGG + Intergenic
904448785 1:30597805-30597827 CTGGGGTGGGGGAGCTGCCAAGG - Intergenic
907250230 1:53133221-53133243 CTGAGCCTGTGAATCTGTCAGGG - Intronic
909713602 1:78680237-78680259 TTGAGGGTGTAGTGCTGTCAGGG - Intergenic
911064007 1:93771641-93771663 GTGATGTTTTAGAGCTGTCAGGG + Intronic
913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914018701 1:143844984-143845006 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
914657254 1:149753187-149753209 CTGTGGTTGTGCAGCAGACAGGG + Intergenic
915117971 1:153612287-153612309 CTGAGGTGGAGGAGCTGCCGAGG + Intronic
915559206 1:156676725-156676747 CGGAGGTAGAGGAGCTGGCAAGG - Exonic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
915714444 1:157931111-157931133 CTGGGGTTGTGGTGCTCTCCAGG - Intergenic
915722875 1:157996726-157996748 CTGAGGTTGGGGAAGAGTCAGGG + Intronic
915963260 1:160284485-160284507 CTGAGGATGTGGCGATTTCAGGG - Intronic
918869373 1:189948958-189948980 CTGAGGTAGAAGAGCTGTTAAGG + Intergenic
919893794 1:201995572-201995594 CTGGGGTTGGGGAGCTGAGATGG + Intronic
920455862 1:206100605-206100627 CAGAGATTGTTTAGCTGTCAGGG + Intronic
921952671 1:220946653-220946675 CTGAGTTTGTGTGGCTTTCAGGG + Intergenic
922394026 1:225177777-225177799 CTGCAGTGGTGGAGCTCTCATGG + Intronic
924241448 1:242044958-242044980 CTGCAGTGGTGGAGCTCTCATGG + Intergenic
1062876071 10:943851-943873 CTGATGTTGTGGAGCTTACGTGG - Intergenic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1067450143 10:46377055-46377077 CTGAGGTGGGGCAGCTGTCCTGG + Intronic
1067587099 10:47482708-47482730 CTGAGGTGGGGCAGCTGTCCTGG - Intronic
1067634158 10:47990475-47990497 CTGAGGTGGGGCAGCTGTCCTGG - Intergenic
1067702966 10:48587026-48587048 CTGAGGTTGCAGAGCAGCCAGGG - Intronic
1069532416 10:69229201-69229223 CTGAGGTTTGGGAGCTCTCAGGG + Intronic
1070050700 10:72886846-72886868 CTGAAGTTGTGGAGGTGGGAGGG - Exonic
1070904409 10:80059233-80059255 CTGAAGTAGGGGAGCTTTCAAGG - Intergenic
1071531978 10:86397227-86397249 CTGATGCTGTGCAGGTGTCATGG - Intergenic
1072664565 10:97384280-97384302 CTGAGGTTGTGGAGTTCTCAGGG - Intronic
1072664633 10:97384506-97384528 CTGAGGTTATGGAGTTCTCAGGG - Intronic
1073420495 10:103420379-103420401 CTGAGGTTTTTGAGGTGTTAAGG + Intronic
1074520015 10:114211339-114211361 CTGGAAGTGTGGAGCTGTCATGG + Intronic
1075727316 10:124617211-124617233 CTGGGGTTGCGGAGCAGGCAGGG - Exonic
1076047265 10:127304200-127304222 CTGAGGCTGCGGAGCAGTCGGGG + Intronic
1076314479 10:129531027-129531049 CTCAGGCTGGGGTGCTGTCAGGG + Intronic
1076783542 10:132737608-132737630 CTGTGGCTGAGGAGCTGGCAGGG - Intronic
1077948534 11:6928985-6929007 ATGAGTTTGGGGAGATGTCAAGG + Intronic
1078108473 11:8373344-8373366 CTGGGGGTGTGGAGCCCTCATGG + Intergenic
1078388176 11:10911506-10911528 CAGAGTTTGTGGACCTGTGATGG + Intergenic
1078959513 11:16248413-16248435 CTGCAGAGGTGGAGCTGTCATGG - Intronic
1080222421 11:29921491-29921513 GGGAGGTTGTTGAGCTGGCAAGG - Intergenic
1081484451 11:43516706-43516728 GTGAGCCTGGGGAGCTGTCAGGG + Intergenic
1083983666 11:66194989-66195011 CTGAGGTGGTGGATCACTCAAGG + Intronic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1085040295 11:73322890-73322912 CAGAGGATGTGGAGCTGGCGAGG + Intronic
1090025806 11:123166651-123166673 CTGAGATGGTGGAGCTCTTATGG - Intronic
1090333587 11:125948591-125948613 CTGTGGTGGGGGGGCTGTCAGGG + Intergenic
1091498468 12:991757-991779 ATGAGGTTGGGGTGCGGTCAGGG + Intronic
1092398771 12:8153616-8153638 CTGGCTTTGTGGAGCTGTGATGG + Intronic
1094506276 12:31064113-31064135 CTGAGGTTGAGGACATGTCCAGG - Intergenic
1094713812 12:32991479-32991501 CTGAGTTCCTGTAGCTGTCATGG - Intergenic
1095395387 12:41756877-41756899 CTGCAGGGGTGGAGCTGTCACGG - Intergenic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1100258383 12:92907315-92907337 CTGACTTTGTGGTGCTCTCAAGG - Intronic
1103188380 12:118980842-118980864 CTGTGCATGCGGAGCTGTCAAGG - Intergenic
1110272080 13:73602335-73602357 CTGAGTTTGTGGTGCTGCCAAGG - Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1114846414 14:26328351-26328373 CTGAGTTTGTGAACCTCTCATGG + Intergenic
1118125958 14:62904535-62904557 CTGATGATGTGGAGATGTCTTGG + Intronic
1118393949 14:65319687-65319709 CTGAACTTCTGGATCTGTCAAGG - Intergenic
1122255736 14:100474356-100474378 CTGTGTTTGTGGAGATGTGAAGG - Intronic
1122302509 14:100739059-100739081 CTGAGGTTGGAGAGCTGGAAGGG - Intergenic
1122707902 14:103632923-103632945 CTGAGGTTGTGCTGCTGTAAAGG + Intronic
1123004032 14:105312940-105312962 GTGAGGTTATGCAGCTGCCAGGG - Exonic
1124476457 15:30039172-30039194 TTGAGGTGGTGGAGCTGGAAAGG - Intergenic
1125969231 15:43898660-43898682 CTGAAGTTGGAGTGCTGTCAGGG + Intronic
1126328349 15:47505951-47505973 CTGAAGGTGTGGAGAAGTCAGGG + Intronic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1128074620 15:64818424-64818446 CTGAGGGCAGGGAGCTGTCATGG + Intronic
1129652770 15:77503397-77503419 CTCAGGTTTTGGAGCTGGAAAGG - Intergenic
1130713267 15:86305159-86305181 CTGAGTTTGGGGAACTGACAAGG - Intronic
1131252614 15:90840160-90840182 CCGTGGATGTGGTGCTGTCAGGG - Intergenic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132178885 15:99736516-99736538 CTCAGGTTGTGGTGGAGTCAAGG + Intergenic
1132694995 16:1198123-1198145 CTGAGGTTCTGGGGCTCCCAAGG + Intronic
1132726273 16:1339631-1339653 TTGAGGTGGGGAAGCTGTCAGGG - Intronic
1132731746 16:1366304-1366326 CAGAGGATGTGGTGCTGACAGGG + Intronic
1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738157 16:1397557-1397579 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738186 16:1397644-1397666 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738215 16:1397731-1397753 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738244 16:1397818-1397840 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1133285985 16:4691070-4691092 CAGAGGCCGTGGAGCTGCCACGG - Intergenic
1136510612 16:30736339-30736361 CTGAGGATGAGGAGATGTCCCGG + Exonic
1138044124 16:53703626-53703648 CTGAGGATGTGGAGGTGTCTTGG + Intronic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1141093708 16:81148122-81148144 CTGAGGTTGAGGACCTGCCTTGG + Intergenic
1141543204 16:84743062-84743084 CTGATGTTCTGGGGCCGTCAAGG - Intronic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1144820305 17:18068464-18068486 CTGTGGCTGTGGAGCTCTCCAGG + Intergenic
1145053643 17:19683446-19683468 CTGAGGTTGTGGGCCTGTTTGGG + Intronic
1145208613 17:20997376-20997398 CTGGGGTGGGGGAGCTTTCAGGG - Intergenic
1145278743 17:21453465-21453487 GTGAGGTTGTGGGGCTCTCGTGG + Intergenic
1145399109 17:22517020-22517042 GTGAGGTTGTGGGGCTCTCCTGG - Intergenic
1146845005 17:36176889-36176911 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1146857312 17:36264824-36264846 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1146863304 17:36323551-36323573 CTGAGGTTAGGGAGCAGCCATGG + Intronic
1146880580 17:36439820-36439842 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1147066164 17:37924139-37924161 CTGAGGTTAGGGAGCAGCCATGG + Intergenic
1147076106 17:37989359-37989381 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1147077697 17:38003700-38003722 CTGAGGTTAGGGAGCAGCCATGG + Intronic
1147087631 17:38068905-38068927 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1147093634 17:38127634-38127656 CTGAGGTTAGGGAGCAGCCATGG + Intergenic
1147103573 17:38192854-38192876 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1147138709 17:38449682-38449704 GCGAGGTTGTGGAGTGGTCATGG + Intronic
1149848152 17:60019372-60019394 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1149862024 17:60127173-60127195 CTGAGGTTAGGGAGCAGCCAGGG + Intergenic
1150086504 17:62275954-62275976 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1151170511 17:72241871-72241893 CTGAGTTTGAGGGGCTTTCACGG - Intergenic
1151427307 17:74039348-74039370 CTGAGGTTGTGGTTTTTTCAGGG - Intergenic
1151883183 17:76906744-76906766 CTGAGAGTGTGGGGATGTCAAGG + Intronic
1152641607 17:81451750-81451772 CTGGGGCAGTGGAGCTGTCCAGG - Exonic
1157690260 18:49676003-49676025 CTAAGGTTTTGGAACTGTCTTGG + Intergenic
1159357878 18:67359562-67359584 ATGAGATTTTGGAGCGGTCAGGG + Intergenic
1161289415 19:3485035-3485057 GGGAGGATGGGGAGCTGTCAGGG + Intergenic
1161777623 19:6272279-6272301 CTGAGTTGGTGGCGCTGTCCTGG + Intronic
1165362606 19:35346053-35346075 CTGAGGTTGGGGTGCTGTTGGGG + Intronic
1165382231 19:35489607-35489629 CTGAGCTGGGGGGGCTGTCAGGG - Intronic
1165897281 19:39150379-39150401 CTGAGGATGAGGTGGTGTCAAGG - Intronic
1167268652 19:48495960-48495982 CTATGGTGGTGGAGTTGTCAGGG + Intronic
1167679278 19:50909499-50909521 CAGAGGTTCAGGAGCAGTCAGGG + Intronic
925266382 2:2569385-2569407 CTGAGGATGTGCAGCTGTCGCGG - Intergenic
925267146 2:2574220-2574242 GTGGGGTTGTGGTGATGTCATGG + Intergenic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
927662855 2:25007435-25007457 CTGACGTTGTGGACCTTCCAAGG + Intergenic
927935326 2:27072637-27072659 CTGTTGCTCTGGAGCTGTCAGGG + Intergenic
928215372 2:29356929-29356951 CTGAAGATGTGGAGCAGTCATGG - Intronic
928411641 2:31058734-31058756 ATAATGTTGTGGAGATGTCATGG - Intronic
929301759 2:40311874-40311896 CTGAGTTTGTGGAGATGATAAGG - Intronic
929466528 2:42149632-42149654 CCGAGGTTGTGGTGCTATCTTGG - Intergenic
930596680 2:53398129-53398151 CTGAGGTTGAGGAGGTGCCCAGG - Intergenic
930607815 2:53510539-53510561 CTGGGGCTGTGGAGCTGGCTGGG - Intergenic
935313810 2:101811510-101811532 GTGAGCTTGGGCAGCTGTCAAGG - Intronic
936890680 2:117366345-117366367 CTGCAGGAGTGGAGCTGTCATGG - Intergenic
940144158 2:150527813-150527835 CTGTGCTTGTGGAATTGTCAGGG - Intronic
942774769 2:179568079-179568101 GTGAGGTTTTGGAGCAGGCAGGG - Intronic
946125872 2:217562156-217562178 CTGAGGCTGTGGCTGTGTCACGG + Intronic
947766045 2:232638170-232638192 GTGAGCTGGTGGAGCAGTCAAGG + Intronic
947943942 2:234083604-234083626 CTGAGGGTGTGGCTCTGTGATGG - Intergenic
948794652 2:240396111-240396133 CTGAGGTCATGGACCTGCCAGGG + Intergenic
949031316 2:241798778-241798800 CTGGGGTTCGGGAGCTGACAGGG - Intronic
1168932721 20:1636848-1636870 CTGAGGTTGGTGAGCTCTCCTGG - Intronic
1171391042 20:24802000-24802022 GGGAGGTTTTGGGGCTGTCAAGG - Intergenic
1171400518 20:24870482-24870504 CTGAGGATGTGGGTCAGTCAGGG - Intergenic
1173853997 20:46238039-46238061 CTGAGGATGGGGAGGTGCCAGGG - Intronic
1174460149 20:50676709-50676731 CTGATGTTGTGGAGCCCTTAGGG - Intronic
1174547295 20:51334885-51334907 CTGAGGGAGTGGGGATGTCAAGG + Intergenic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1176194025 20:63828809-63828831 CTCAGGCTGTGGAGCCGTCTAGG + Intronic
1179127924 21:38608641-38608663 CTGAGGGTTTGGAGGTGTCTGGG + Intronic
1179188787 21:39106337-39106359 CTGTGGTTGTGCAGCTCACATGG + Intergenic
1181087694 22:20449932-20449954 CGGAGGCTCTGGAGCTGTCCGGG - Intronic
1181517562 22:23423949-23423971 CTGAGGTTGGGGAGATGGCCTGG + Intergenic
1184188625 22:42880488-42880510 CTGAGGCTGCGCTGCTGTCAGGG - Intronic
1184306644 22:43607388-43607410 CTGTCTTTGGGGAGCTGTCAGGG - Intronic
1185149706 22:49157137-49157159 CGGATGCTGTGGAGCTGCCAAGG - Intergenic
951710565 3:25581846-25581868 CTGAGGTCAGGGAGCTGGCATGG - Intronic
952734935 3:36680265-36680287 CTGAGATTTTGGAGGAGTCAGGG - Intergenic
953495890 3:43386751-43386773 CTGGGACTGAGGAGCTGTCAGGG - Intronic
954078738 3:48200111-48200133 ATGAGGGTGTTGAGCTTTCATGG - Intergenic
954814720 3:53271461-53271483 CTGAGGTTGTTGATCTGGGAAGG + Intergenic
957497439 3:81009350-81009372 CTATGGTGGTGGAGCAGTCATGG + Intergenic
961346404 3:126266431-126266453 GGGAGGTGGTGGAGCTGGCATGG + Intergenic
961646710 3:128396619-128396641 ATGAGGCTGTGGTGCTGTGAAGG + Intronic
963624445 3:147653511-147653533 TTGAGGGTGTGGAGCTCTCCTGG - Intergenic
965929885 3:174029619-174029641 ATGAGATTTTGGAGCAGTCAGGG + Intronic
968464485 4:743706-743728 CTGAGGGTGTGGGGCGGTTAGGG + Intronic
968581782 4:1398692-1398714 CTGAGGCTGTGGGGCTGGCTTGG + Intergenic
973624783 4:52760495-52760517 CTGAGGTTTTGGAGCTGGACAGG + Intergenic
977758325 4:100700360-100700382 CTGAGTTTGTGGTACTGTTATGG - Intronic
979033912 4:115687100-115687122 CTGAGATTGTGGAGTTTTCCAGG + Intergenic
979170085 4:117590641-117590663 CAGAGGTTATGGTGCTCTCATGG + Intergenic
981156493 4:141442593-141442615 CCGAGGATGTGGAGATTTCAGGG - Intergenic
981581155 4:146249484-146249506 ATGAGGTTTTTGGGCTGTCATGG + Intergenic
982356777 4:154478511-154478533 CTGAGGTTGGGTAGCAGTCAAGG + Intronic
985913248 5:2898879-2898901 CTGAGGAAGGGGAGCTGACAGGG - Intergenic
986302249 5:6486962-6486984 CAGAGGGTGTGGAGCAGGCAGGG - Intronic
987309833 5:16671506-16671528 CCGAGGTTGGGGACCTGCCATGG - Exonic
988928849 5:36015875-36015897 CTGAAGGGGTGGAGCTCTCATGG + Intergenic
989129762 5:38095342-38095364 CTGAGGTTTAGGAGGTGGCAGGG - Intergenic
991003177 5:61803316-61803338 CTGAGGCTGGGGACATGTCAAGG - Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
999315839 5:150583450-150583472 CTGATGTTGTCGAGCTTTTAGGG + Intergenic
1004440229 6:15642590-15642612 CTGAGGGTGTGGAGATCCCAGGG - Intronic
1005052379 6:21696517-21696539 CTGAGTGTGTGGACCTGTAAGGG + Intergenic
1005691465 6:28311090-28311112 CTGCTGTTGTGGAGGTGGCAGGG + Intergenic
1006516707 6:34549535-34549557 CTGTGGTTCGGGAGCTGTCAGGG - Intronic
1007079680 6:39090546-39090568 CTGAGAGTGAGGTGCTGTCAGGG + Intergenic
1007766213 6:44161794-44161816 CTGAGGGTGTTGAGCTCTCCTGG - Intronic
1010473052 6:76252472-76252494 ATGATGTTGTGATGCTGTCATGG + Intergenic
1012030399 6:94052885-94052907 CAGGGGTTGTGCAGCTGTGAGGG - Intergenic
1012093973 6:94934420-94934442 GGGTGTTTGTGGAGCTGTCAGGG - Intergenic
1017000333 6:149992027-149992049 CTGTGGCTTTGCAGCTGTCATGG + Intergenic
1017107751 6:150904136-150904158 CTCAGGCTGAGGAGCTGTCCTGG + Intronic
1019270015 7:141752-141774 CTGAGGTTGTGTTCCTGTCGGGG + Intergenic
1019270037 7:141854-141876 CTGAGGTTGTGTTCCTGTCGGGG + Intergenic
1019270076 7:142009-142031 CTGAGGTTGTGTTCCTGTCGGGG + Intergenic
1019270111 7:142162-142184 CTGAGGTTGTGTTCCTGTCGGGG + Intergenic
1019901193 7:4021953-4021975 CTGAGGCTGAGGAGCCCTCAGGG - Intronic
1020809423 7:12833376-12833398 ATGAGGTTTTGGAGGTGCCAGGG - Intergenic
1024032581 7:45476088-45476110 CAGAGGTTGGGGGGCTATCAGGG + Intergenic
1025186555 7:56864502-56864524 GAAAGGTTGGGGAGCTGTCAGGG + Intergenic
1025239085 7:57256676-57256698 CTGTGGGCGTGGAGCTGTCCCGG + Intergenic
1025685367 7:63712405-63712427 GAAAGGTTGGGGAGCTGTCAGGG - Intergenic
1026175011 7:67988858-67988880 CTGAGTTTGTTAAGCTGTGAAGG - Intergenic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1026685125 7:72503386-72503408 CTGAGGTGGTGGTGCTCTCGGGG + Intergenic
1028942950 7:96545206-96545228 CTGGGGTTGTGGAGTTGTATGGG + Intronic
1029510355 7:100990767-100990789 CTGAGTTTGTGGAGCTGTCAAGG - Exonic
1029510497 7:100991682-100991704 CTGAAGTTGTGGAGCTTTCAGGG - Exonic
1029510512 7:100991835-100991857 CTGAGATTGTGGAGCTATCACGG - Exonic
1029510643 7:100992666-100992688 CTGAAGTTGTGTCGCTTTCAGGG - Exonic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029510708 7:100993161-100993183 CTGGCGTGGTGGTGCTGTCAGGG - Exonic
1029510749 7:100993413-100993435 CTGAGCTTGTGGTGCTGTCAGGG - Exonic
1029510757 7:100993497-100993519 CAGGGCTTGTGGAGCTGGCAGGG - Exonic
1029510787 7:100993662-100993684 CCGAAGTTGTGGAGCTGGCAGGG - Exonic
1029510850 7:100994082-100994104 CTGAGGTTGTGGTGCTGTGAGGG - Exonic
1029510927 7:100994583-100994605 CTGAGGTGGTGGTGCTGTCAGGG - Exonic
1029510968 7:100994835-100994857 CAGCGCTTGTGGAGCTGGCAGGG - Exonic
1029511132 7:100995915-100995937 CTGAAGCTGTGGAGCTTTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511199 7:100996410-100996432 CTGGCGTGGTGGTGCTGTCAGGG - Exonic
1029511242 7:100996662-100996684 CTGAGCTTGTGGTGCTGTCAGGG - Exonic
1029511250 7:100996746-100996768 CAGGGCTTGTGGAGCTGGCAGGG - Exonic
1029511281 7:100996911-100996933 CCGAAGTTGTGGAGCTGGCAGGG - Exonic
1029511344 7:100997331-100997353 CTGAGGTTGTGGGGGTGCGAGGG - Exonic
1029511425 7:100997832-100997854 CTGGCGTGGTGGTGCTGTCAGGG - Exonic
1029511468 7:100998084-100998106 CTGAGCTTGTGGTGCTGTCAGGG - Exonic
1029511476 7:100998168-100998190 CAGGGCTTGTGGAGCTGGCAGGG - Exonic
1029511507 7:100998333-100998355 CCGAAGTTGTGGAGCTGGCAGGG - Exonic
1029511570 7:100998753-100998775 CTGAGGTTGTGGTGCTGCGAGGG - Exonic
1029511648 7:100999254-100999276 CTGAGGTGGTGGTGCTGTCAGGG - Exonic
1029511690 7:100999506-100999528 CAGCGCTTGTGGAGCTGGCAGGG - Exonic
1029511860 7:101000586-101000608 CTGAAGTTGTGTCGCTTTCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511927 7:101001081-101001103 CTGGCGTGGTGGTGCTGTCAGGG - Exonic
1029511966 7:101001333-101001355 CTGAGCTTGTGGTGCTGTCAGGG - Exonic
1029511974 7:101001417-101001439 CAGGGCTTGTGGAGCTGGCAGGG - Exonic
1029512005 7:101001582-101001604 CCGAAGTTGTGGAGCTGGCAGGG - Exonic
1029512068 7:101002002-101002024 CTGAGGTTGTGGTGCTGCGAGGG - Exonic
1029512145 7:101002503-101002525 CTGAGGTGGTGGTGCTGTCAGGG - Exonic
1029512187 7:101002755-101002777 CAGTGCTTGTGGAGCTGGCAGGG - Exonic
1029512352 7:101003835-101003857 CTGAAGTTGTGTTGCTTTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512433 7:101004414-101004436 CTGAAGCTGTGGAGCTTTCAGGG - Exonic
1029512494 7:101004906-101004928 CTGAGGTGGTGGTGCTGGCAGGG - Exonic
1029619758 7:101682723-101682745 TTGAGATTGTGGAGCTGCCGTGG + Intergenic
1030501367 7:110363953-110363975 CTAAGCCTGTGGAGCAGTCAAGG - Intergenic
1031845035 7:126795309-126795331 ATGAGATAGTGGAGCTGTGATGG - Intronic
1036461813 8:8960133-8960155 CTGCAGGTGTGGGGCTGTCATGG - Intergenic
1043504082 8:80885813-80885835 CTGAGGTTGGGGAGCAGGCTTGG + Intergenic
1044233966 8:89809162-89809184 CTGCAGTTGGGGAGCTCTCATGG + Intergenic
1045993194 8:108334144-108334166 GTGAGTTAGTGGAGCTGTGAGGG + Intronic
1053002406 9:34584566-34584588 CTGAGGCTGTGTAGCTGTTGTGG - Intronic
1055104059 9:72494192-72494214 CAGAGGTTGTGTTGCTGTGAAGG - Intergenic
1059108479 9:111532207-111532229 CTGAGGTGGTAGAGCTGTAAGGG + Intronic
1059449420 9:114361048-114361070 CTGAGGCTGGGGAGGTGGCAGGG - Intronic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1062288735 9:135785301-135785323 CTGAGGTCGTGGGGCTGCAAAGG - Exonic
1187840181 X:23479010-23479032 CTGAGATTTTGAAGCTGTGACGG + Intergenic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1189438039 X:41010071-41010093 CGGAGGTGGTGGACCTGGCAGGG - Intergenic
1189546532 X:42048021-42048043 CTGAGTTTTTGCTGCTGTCAGGG + Intergenic
1190286670 X:48966122-48966144 CTGAGGCAGTGGAGTTGGCAAGG + Exonic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1192198520 X:69048420-69048442 CTGTGGGAGGGGAGCTGTCATGG - Intergenic
1193153456 X:78148253-78148275 CTGCAGGCGTGGAGCTGTCATGG + Intergenic
1194125061 X:90007181-90007203 CTGATGGTGTGGAGGTCTCAGGG + Intergenic
1195836392 X:109119401-109119423 CTGAGGGTGTTGAGATGTGATGG - Intergenic