ID: 1029513002

View in Genome Browser
Species Human (GRCh38)
Location 7:101008483-101008505
Sequence CCCTGTCTCCCAAAACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 409}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029513002 Original CRISPR CCCTGTCTCCCAAAACCCTG AGG (reversed) Intronic