ID: 1029513666

View in Genome Browser
Species Human (GRCh38)
Location 7:101012689-101012711
Sequence GGGTGGGCAAAGACTCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029513662_1029513666 -7 Left 1029513662 7:101012673-101012695 CCCAGCTGCATGTCTAGGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1029513658_1029513666 2 Left 1029513658 7:101012664-101012686 CCTCACAAGCCCAGCTGCATGTC 0: 1
1: 0
2: 1
3: 23
4: 167
Right 1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1029513654_1029513666 16 Left 1029513654 7:101012650-101012672 CCCCATTTGAGCCTCCTCACAAG 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1029513655_1029513666 15 Left 1029513655 7:101012651-101012673 CCCATTTGAGCCTCCTCACAAGC 0: 1
1: 0
2: 5
3: 16
4: 569
Right 1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1029513664_1029513666 -8 Left 1029513664 7:101012674-101012696 CCAGCTGCATGTCTAGGGTGGGC 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1029513656_1029513666 14 Left 1029513656 7:101012652-101012674 CCATTTGAGCCTCCTCACAAGCC 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1029513657_1029513666 5 Left 1029513657 7:101012661-101012683 CCTCCTCACAAGCCCAGCTGCAT 0: 1
1: 0
2: 0
3: 28
4: 251
Right 1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029513666 Original CRISPR GGGTGGGCAAAGACTCCCAC GGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900809484 1:4790525-4790547 GTGTGGGCAAACACCCCCTCTGG - Exonic
900860308 1:5224377-5224399 GGGAGGGCAGAGGTTCCCACTGG - Intergenic
902029561 1:13411896-13411918 GGGTGGGCAAAAATTACCACTGG - Intronic
902221493 1:14968719-14968741 GGCAGGGAAAAGGCTCCCACAGG - Intronic
902283186 1:15389158-15389180 GTGTGGGTAAAGAATCCTACTGG + Intronic
905366681 1:37455389-37455411 GGCTGGGCAGAGGCACCCACAGG - Intergenic
907287452 1:53390892-53390914 GGGCTGGCAGTGACTCCCACAGG + Intergenic
915024899 1:152818485-152818507 GGCTGGGCAAAGAGTCTGACTGG + Intergenic
915513631 1:156400596-156400618 GGGTGGGCAAAGCCGGGCACCGG + Intergenic
915947261 1:160162636-160162658 GGGTGGGAGAAGGCTCCTACTGG - Intronic
917985124 1:180308767-180308789 GGGTGAGCAAACACTCTAACTGG - Intronic
919728469 1:200898554-200898576 GGCTGGGCTGAGACTCCCAAGGG + Intronic
924234703 1:241990980-241991002 GGGAGGGCAAGGACAGCCACAGG + Intergenic
1067078106 10:43199423-43199445 GGGCTGGCAAAGCCTCACACAGG + Intronic
1069889924 10:71646331-71646353 GGATGGGCAGAGACTCTAACAGG + Intronic
1071198007 10:83184091-83184113 GCATGGGTAAAGACCCCCACAGG + Intergenic
1076160531 10:128240993-128241015 GGGTGGGCGGTGACTCCCAGGGG + Intergenic
1076233491 10:128843367-128843389 GTGTGTGCATAGACACCCACAGG + Intergenic
1077143171 11:1033751-1033773 AGGTGGGAAAAGTCTCCCTCTGG - Intronic
1081522076 11:43891749-43891771 GAGAGGGCAAAGAGTCACACTGG - Intronic
1082781294 11:57289427-57289449 GTGAGGGCAAAGGCTCCCGCGGG + Intergenic
1082813932 11:57495997-57496019 GAGTGGGCAGAGACTCTCCCTGG - Intronic
1084185062 11:67467255-67467277 AGGAGGGCAGAGCCTCCCACGGG + Intronic
1084959242 11:72707577-72707599 GGCTGGGCAGAGCCCCCCACTGG - Intronic
1085802989 11:79608590-79608612 GTGTCGGCAAAGACTCCCTGAGG - Intergenic
1085857162 11:80188285-80188307 GACTGGACAAAGCCTCCCACGGG - Intergenic
1092052256 12:5480296-5480318 GGGTGGAAAAACAATCCCACCGG + Intronic
1097125475 12:56771107-56771129 GCCTGAGCAAAGACTGCCACTGG - Intronic
1098162486 12:67658519-67658541 CGGTTGCCAAAGCCTCCCACCGG + Exonic
1101286542 12:103319342-103319364 GAGTGGGGAAAGAGTCACACAGG + Intronic
1101524063 12:105511598-105511620 GAATGGGCAAGGATTCCCACAGG - Intergenic
1104423449 12:128655832-128655854 TGGTGGACAAAGACTACTACTGG - Intronic
1104899859 12:132183018-132183040 GGGATGGGAAAGACTCCCAGAGG - Intergenic
1105069450 12:133225856-133225878 TGGTGGGCAGAGCCTCCCTCAGG + Intronic
1105213937 13:18273629-18273651 GGGTGGGCCCAGCCTCCCACAGG + Intergenic
1110880493 13:80566441-80566463 GGGCTGGGAAAGATTCCCACTGG - Intergenic
1113255263 13:108498502-108498524 TGGTGGGCAGAGAATCACACAGG - Intergenic
1117055100 14:51904175-51904197 GGGTGCTCAAAAACTGCCACTGG + Intronic
1120321264 14:82964461-82964483 GGGAGGGGAAGGACTCACACTGG - Intergenic
1121119085 14:91364626-91364648 GGGTGGGCCAGGACCCCCTCAGG + Intronic
1122982621 14:105198475-105198497 GGGAGGGCAAGGAGTCCCAGGGG + Intergenic
1127922103 15:63502532-63502554 GGGTCGGGAAAGACTCCCTCAGG + Intergenic
1131680173 15:94713317-94713339 GGGTGGGCAAAGGCTGGGACAGG + Intergenic
1132372766 15:101309668-101309690 GCGGGGGCAGAGACTCCCAGGGG - Intronic
1132573394 16:653775-653797 GGGTTGGCAAGGACCACCACGGG + Exonic
1134262653 16:12665000-12665022 AGCTGGGCAGAGACCCCCACGGG - Exonic
1136220618 16:28825400-28825422 GGGTGGGAGAAGACACTCACAGG - Exonic
1140034686 16:71363346-71363368 GGGTGCTCAAAGCCTCTCACAGG + Intronic
1142482527 17:227661-227683 GGGTGGGGAGATGCTCCCACTGG + Intronic
1146399890 17:32494212-32494234 GGGTGAGCAGAGTCACCCACAGG - Exonic
1146610303 17:34299085-34299107 GGATGGGAAAAGAAACCCACTGG - Intergenic
1146891906 17:36511762-36511784 GGGTGGGCATGGAGGCCCACAGG - Intronic
1149521814 17:57323486-57323508 AGGAGGGCAAAGGCTTCCACTGG - Intronic
1151303947 17:73250952-73250974 GGGTGGACAAAGGAACCCACAGG - Intronic
1151749202 17:76027166-76027188 GGCTGAGCAAAGGCTCCCAGGGG - Exonic
1159682497 18:71372336-71372358 GGGTGGCAAGAGAATCCCACAGG - Intergenic
1160323261 18:77915778-77915800 TGGTGGTGAAAGACACCCACAGG - Intergenic
1160338038 18:78060143-78060165 GAGTGGGCAGAGCCTCCCAGAGG - Intergenic
1163124558 19:15237949-15237971 GTGTGGGGAAAGACTCCCGGCGG + Exonic
1166122141 19:40692316-40692338 GGGTGGCGAAAGGCTCCCCCAGG + Exonic
1167245922 19:48373214-48373236 GGGTGTGGAAAGACTCCCCTGGG + Intronic
925172470 2:1758883-1758905 GGCTGGCCCAAGGCTCCCACAGG - Intergenic
925351816 2:3206315-3206337 GGGTGTGCAGAGCCTCCCTCAGG - Intronic
931670792 2:64644910-64644932 GAGTGGGCAAAAATTCCAACAGG + Intronic
933796530 2:85924464-85924486 GGAAGGGCAAAGTCTCCCCCAGG - Intergenic
934300387 2:91773120-91773142 GGGTGGGCCCAGCCTCCCACAGG - Intergenic
934859148 2:97749486-97749508 GGGTGGGCAATGACTGTCAGGGG + Intergenic
934960963 2:98672489-98672511 GGCTGAGCAAAGACTCTCATTGG - Intronic
938970328 2:136425566-136425588 GGTTTTCCAAAGACTCCCACAGG - Intergenic
946530090 2:220561395-220561417 GGGTGGGGAAAAACACACACTGG + Intergenic
946846099 2:223860253-223860275 GGGTGGGGAAAGGCTCTTACTGG - Intronic
1169098124 20:2921785-2921807 GGGTGGGCAGAGACTTCGTCAGG - Intronic
1170935555 20:20806036-20806058 GGGTTGGCAAGGAATTCCACTGG + Intergenic
1173608521 20:44349683-44349705 GGCTTGGCAAAGAATGCCACAGG + Intronic
1175960074 20:62631481-62631503 GGCTGGGCCAAGTCACCCACTGG - Intergenic
1180945430 22:19689779-19689801 TGGTGGCCAGAGACTCCCAATGG + Intergenic
1181698745 22:24608253-24608275 GGGTGGGCCCAGCCTCCCACAGG - Intronic
1182122944 22:27798742-27798764 GGCTGGGCCAAGCCGCCCACCGG + Exonic
1184160084 22:42692722-42692744 GGGTGTCCACAGCCTCCCACTGG + Exonic
1185117502 22:48945995-48946017 GGGTGCCCAGAGACTCCCACAGG - Intergenic
1185286162 22:50000772-50000794 GGGTGGCCAGGGCCTCCCACCGG - Exonic
950125527 3:10507512-10507534 GGGTGGGCAAAGACGGGCAGAGG + Intronic
952884113 3:38002352-38002374 GGCTGGGCAAGGGCTCCCAGGGG - Intronic
962350127 3:134650551-134650573 GGGAGGAAAAAGACTCCCAGGGG + Intronic
963080136 3:141384194-141384216 GGGTGGACAGAGAACCCCACAGG + Intronic
965386641 3:168054243-168054265 GGGGGGGCAAAACCTCCCAGTGG + Intronic
969459450 4:7321134-7321156 GGGTAGGCAAAGGCACGCACAGG - Intronic
969633216 4:8350599-8350621 GGGAGGGCAGAGACCCACACTGG + Intergenic
983205044 4:164902792-164902814 GGGTGTGCAGAGACCCCCTCTGG - Intergenic
984845774 4:184106776-184106798 GTGGGGGCAAGGACTCCCAGTGG + Intronic
985681679 5:1259031-1259053 GAGTGGACACAGACGCCCACAGG + Intronic
985681852 5:1259766-1259788 GAGTGGACACAGACGCCCACAGG + Intronic
996076191 5:119197572-119197594 AGGTGGGCAAAGAAACCCAGTGG - Intronic
997506152 5:134418904-134418926 GGGTTGGCAAAGTGGCCCACAGG - Intergenic
999271435 5:150298443-150298465 GGGTGGGCAGACACTCCTTCCGG + Exonic
1002107422 5:176887046-176887068 GAGCGGGCAGAGCCTCCCACTGG - Exonic
1002963545 6:1940433-1940455 GGGTGGCCAGAGATTACCACAGG - Intronic
1003719097 6:8680452-8680474 GGGTCGGCAAAGACTGCCTGTGG + Intergenic
1004258264 6:14084878-14084900 GGGTGGCCAAACACGCACACTGG + Intergenic
1005029206 6:21493573-21493595 TGCTGGGCAGAGACTCCCAGTGG - Intergenic
1014595537 6:123333205-123333227 TGGTGGGAACAGACTCCCAGTGG + Intronic
1019667084 7:2257317-2257339 GGGAGGGGAAAGGCTCCCACGGG + Intronic
1021527800 7:21608235-21608257 TGGTGGGCAAAGAATCCAAATGG + Intronic
1022563385 7:31373072-31373094 GGGTGGGCACAGAAACCCACAGG - Intergenic
1023772273 7:43568695-43568717 CTGAGGGCAAAGACTGCCACTGG - Intergenic
1028746521 7:94333656-94333678 AGGTGGGAAATCACTCCCACTGG - Intergenic
1029160603 7:98548970-98548992 GGTGGGGGAAAGACCCCCACTGG + Intergenic
1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG + Intronic
1038520893 8:28231004-28231026 GGGTGGGCAAAGGCTGTCACTGG + Intergenic
1039931144 8:41990533-41990555 GAGATGGCAAAGACTTCCACAGG + Intronic
1041329609 8:56710526-56710548 GGGTGTGTATAGACCCCCACAGG - Intergenic
1045703854 8:104897622-104897644 GGGAGGGCAACAACTCACACTGG + Intronic
1046210584 8:111069279-111069301 GGGCGGGGAAAGACACACACTGG - Intergenic
1046488748 8:114919511-114919533 GGGTGGGGAACAACACCCACTGG + Intergenic
1049616534 8:143578013-143578035 GGGGGGACAAGGACTTCCACCGG + Intronic
1053484099 9:38439202-38439224 AGGTGGGCAAAGACTGGAACTGG + Intergenic
1055367715 9:75562920-75562942 GGGTGGGGAAAGTCACACACTGG - Intergenic
1056552588 9:87664019-87664041 GGGTGGGTGAAGAGTCCGACTGG - Intronic
1056615230 9:88159981-88160003 GAGTGGGAGAAGACTCCCTCAGG - Intergenic
1062025774 9:134339748-134339770 GGGTGTGCACAGACACACACGGG - Intronic
1185740605 X:2529071-2529093 GGTTTGGCAAAGATTCCCCCAGG + Intergenic
1186441165 X:9587781-9587803 GGGTGGGAAGTGACTGCCACTGG - Intronic
1190212293 X:48458630-48458652 GGCTGGGCAAAGGCTCCACCAGG + Exonic
1190230533 X:48578627-48578649 GGGTGGGCAGGGACTGCCAGAGG + Exonic
1196340579 X:114591157-114591179 GGTTGGTCAATGACTCCCAGAGG + Intronic
1198525208 X:137493668-137493690 GGGTAGGCAAATAAGCCCACAGG + Intergenic