ID: 1029514602

View in Genome Browser
Species Human (GRCh38)
Location 7:101017631-101017653
Sequence GAGTCAACAGTCTCCAGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029514602_1029514608 22 Left 1029514602 7:101017631-101017653 CCCACCCTGGAGACTGTTGACTC 0: 1
1: 0
2: 2
3: 19
4: 157
Right 1029514608 7:101017676-101017698 CGAGCTGCCCCCACCCCCTGAGG 0: 1
1: 0
2: 2
3: 27
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029514602 Original CRISPR GAGTCAACAGTCTCCAGGGT GGG (reversed) Exonic
901063955 1:6485984-6486006 GGCTCCACAGTCTCCAAGGTGGG - Intronic
903018155 1:20375309-20375331 GAGGCAACACTCTGCAGGCTGGG - Intergenic
903578676 1:24354761-24354783 GAGGGAACAGTCTTCTGGGTAGG - Intronic
906611612 1:47207968-47207990 TACTCATCAGACTCCAGGGTGGG - Intergenic
906643004 1:47452679-47452701 GAGGTATCATTCTCCAGGGTTGG + Intergenic
909387848 1:75080395-75080417 GAGTCAAGAGTAAACAGGGTAGG + Intergenic
910202757 1:84716381-84716403 GAATCAACAGTGGCCAGGGGAGG + Intergenic
911395586 1:97304206-97304228 GAGTCAAGAGACTCCAGAGTTGG - Intronic
913236263 1:116785757-116785779 GAGTTACCAGGCTCCAGGCTGGG - Intergenic
913339325 1:117742273-117742295 GAGTAAACAGCCTACAGAGTCGG - Intergenic
914955139 1:152155220-152155242 AAGTCAACAGACTCCAGGACAGG - Exonic
915098659 1:153482962-153482984 GAGTCACCTGTCTGCAGGGTGGG + Intergenic
919085809 1:192919050-192919072 GTGCCATCAGTCTCCAGAGTTGG + Intergenic
919196821 1:194296927-194296949 GAGGCAACACTCTCCAAGGATGG - Intergenic
920403118 1:205689649-205689671 GACTCCACAGTCTTCAGAGTGGG + Intergenic
920457875 1:206114958-206114980 GAGTCAAGAGCCCCCATGGTTGG + Intronic
921951756 1:220937431-220937453 GAGATAAATGTCTCCAGGGTTGG - Intergenic
922030647 1:221794318-221794340 GAGACTACAGTCTCCTGTGTAGG - Intergenic
922732593 1:227958848-227958870 GGGCCAACAGCCTCCAGGGTTGG + Intergenic
923453369 1:234140881-234140903 GAGTCACCATTCTCCTGGGTTGG + Intronic
923645555 1:235816925-235816947 GAGTAAACAGCCTACAGAGTGGG + Intronic
924235448 1:241996200-241996222 GAGTCAGCAGCCCCCAGGGATGG - Exonic
1064283244 10:13969975-13969997 GAGTCAAAAGTCCCCAAGCTGGG - Intronic
1066565078 10:36713429-36713451 GAGTAAACAGTCTACAGATTGGG - Intergenic
1068072740 10:52216322-52216344 CAGTCAACAGGCTCCTGGGCTGG + Intronic
1070280807 10:75046919-75046941 GAGAGAACAGTCTTCATGGTGGG - Intronic
1070641377 10:78172874-78172896 GTGTCAGAAGTCTCCAGGTTGGG - Intergenic
1072226725 10:93376971-93376993 AAGTCACCCTTCTCCAGGGTGGG + Intronic
1072559872 10:96562252-96562274 GAGTCAAGAGTGGCCAGGGAGGG - Intronic
1075571998 10:123552895-123552917 GAGTCAGCAGCCTCCAAGGTTGG - Intergenic
1075820352 10:125302579-125302601 GGGTAAGCAGTTTCCAGGGTTGG - Intergenic
1076706813 10:132306969-132306991 GAGACACCAGTCCCCGGGGTTGG + Intronic
1077543787 11:3160083-3160105 GAGCCAGCAGGCACCAGGGTGGG - Intronic
1078588377 11:12615346-12615368 GAGTCAACAGCCCACAGAGTGGG + Intergenic
1081300190 11:41441749-41441771 GACTTAACAGTGTCAAGGGTGGG - Intronic
1088062901 11:105679092-105679114 AAGTCCACAATCTGCAGGGTGGG + Intronic
1088540785 11:110911502-110911524 GACTCCACACTCTGCAGGGTGGG - Intergenic
1089620113 11:119717342-119717364 GAGTCATCAGTGTCCTGGGCCGG - Intronic
1090445223 11:126759011-126759033 AAGCCAACGGTCTCCAGAGTGGG + Intronic
1094790766 12:33912307-33912329 GAGTAAACAGTCTCTAGAATGGG - Intergenic
1099381658 12:81961909-81961931 GAATTATCAGTATCCAGGGTTGG - Intergenic
1100447695 12:94676499-94676521 TAGCCAACTCTCTCCAGGGTTGG + Intergenic
1102024175 12:109704043-109704065 GAGCCAACAGTATCCTGGGGTGG - Intergenic
1102837975 12:116084729-116084751 GAGCCACCAGTCTCCAGCCTGGG + Intronic
1103506096 12:121443110-121443132 GAGTCCACAGTCTCCAGAGGAGG + Intronic
1104800937 12:131554912-131554934 GAGCCAACAGCCACCATGGTGGG - Intergenic
1105885325 13:24637100-24637122 GGGTGAAAAGACTCCAGGGTGGG - Intergenic
1106329936 13:28730700-28730722 GAATCAAGTGTCACCAGGGTTGG + Intergenic
1106402779 13:29445578-29445600 GATTCAACGGGCTTCAGGGTTGG - Intronic
1109122787 13:58479053-58479075 AAGTCCAAAGTCTGCAGGGTAGG - Intergenic
1111157572 13:84348543-84348565 GTTCCAACAGTCTCCATGGTTGG - Intergenic
1113608288 13:111625759-111625781 AAGTCCACAGTCTGCAGGGCAGG - Intronic
1114246490 14:20919407-20919429 AAGTCAACAATCCCCAGAGTTGG + Intergenic
1114494647 14:23124181-23124203 AAGTCAACATTGCCCAGGGTGGG - Intergenic
1116484489 14:45430893-45430915 GAGTAAACAGCCTACAGAGTGGG - Intergenic
1116723170 14:48527219-48527241 GAGTAAACAGCCTACAGGATGGG - Intergenic
1120673130 14:87387361-87387383 GAGAAAAAAGTCACCAGGGTGGG + Intergenic
1121254134 14:92519214-92519236 GAGCCAAAAGTCTCCTGGATGGG - Intronic
1123008997 14:105338214-105338236 CAGCCAACACTCTCCAGGGCTGG - Intronic
1123773118 15:23548976-23548998 GAGCCACTAGTCTCCAGGGATGG - Intergenic
1125713320 15:41804566-41804588 GACTCCACACTCTCCAGGGCAGG - Intronic
1128125815 15:65192129-65192151 CAGTCAACTGTGTCCATGGTGGG - Intergenic
1129482739 15:75841027-75841049 GACAGAACAGTCTCCAGGATTGG - Intergenic
1129898663 15:79128710-79128732 GGGACAACAATCTGCAGGGTTGG + Intergenic
1130234034 15:82117808-82117830 GAGTCACCAGGCGCCAGTGTTGG + Intergenic
1130541597 15:84824176-84824198 GAGTTCACAGTCTTCAGGGATGG - Intronic
1132833671 16:1942118-1942140 TAGTTTACAGTCTCCAGGGGAGG - Intronic
1141983487 16:87564744-87564766 AAGTCCACAGTCTGCAGGGTGGG + Intergenic
1142494347 17:298394-298416 CAGTCAACAGTCTCCAAGCCAGG + Intronic
1147184888 17:38707677-38707699 GAGGGAACAGTCTGCAGCGTGGG + Intronic
1147863638 17:43538808-43538830 GAGAGAGCAGTCTCCAGGGAAGG - Intronic
1151595720 17:75077147-75077169 GGGTCAGCAGCCTCCAGGGCAGG - Intergenic
1153783011 18:8510769-8510791 GAGACCAAAGTCTCCAGGGCAGG - Intergenic
1156020231 18:32591644-32591666 GCCTGAAGAGTCTCCAGGGTAGG - Intergenic
1159677387 18:71302942-71302964 GATTCTACAGTCTCCATTGTGGG - Intergenic
1161079549 19:2303695-2303717 GAGTCAAGACTTTCCAGGTTTGG - Intronic
1161409559 19:4109330-4109352 GGGACCACAGTCTCTAGGGTGGG - Intronic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
925572346 2:5325617-5325639 GTGGAAACAGTCTCCAGGGGAGG - Intergenic
931073164 2:58677892-58677914 GAGTCCAAAGTCTGCAGGGCAGG + Intergenic
931973119 2:67612457-67612479 GAGTCCACAGTCTGCAGGGTGGG - Intergenic
933171726 2:79132695-79132717 GAGGCAACAGTCTCTAGGCTGGG + Intergenic
933293474 2:80463572-80463594 AAATCAACAGTCTCCACGGGTGG + Intronic
933545423 2:83705178-83705200 GATTCAAAAGTCTCCAGAGAGGG - Intergenic
934732122 2:96666006-96666028 CAGAACACAGTCTCCAGGGTGGG + Intergenic
938021312 2:127907996-127908018 AAGTCAACAATATCCAGGCTGGG + Intergenic
940243315 2:151586921-151586943 AAGTCCAAAGTCTGCAGGGTAGG - Intronic
940244271 2:151597474-151597496 AAGTCCAAAGTCTGCAGGGTAGG - Intronic
940245227 2:151608020-151608042 AAGTCCAAAGTCTGCAGGGTAGG - Intronic
942159222 2:173164489-173164511 GAGTAAACAGTCTACAGAATGGG - Intronic
946394409 2:219435907-219435929 GTGTGAACAGGGTCCAGGGTAGG + Intronic
946548953 2:220779065-220779087 GAATAAACAGTCTACAGGATGGG - Intergenic
946704486 2:222444996-222445018 CAGTTAACTGTCTCCTGGGTCGG - Intronic
948811866 2:240482455-240482477 CAGTCCACAGGCTCCAGGGAGGG + Intronic
1170306822 20:14947640-14947662 GAGTCAGAACTCTGCAGGGTGGG - Intronic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1174283070 20:49453287-49453309 GAGTCCACAGTCTGCCTGGTGGG + Intronic
1174672141 20:52318362-52318384 AAGTCAACAGTGTCAAGGTTGGG - Intergenic
1175084435 20:56446752-56446774 GATTCAACAGTCTCTGGGGTTGG - Intronic
1175349951 20:58310222-58310244 GAGTCCACGGGCTCCAGGGAGGG - Intronic
1178405040 21:32316855-32316877 GAGTCCACAGGCTCCTGAGTGGG + Exonic
1178601354 21:33997516-33997538 AAGTCAAAAATCTGCAGGGTAGG + Intergenic
1178670592 21:34588032-34588054 AAGTCCAAAATCTCCAGGGTGGG - Intronic
1180073155 21:45448823-45448845 GAGTCAACAGACTACAGAGCAGG - Intronic
1182438248 22:30345227-30345249 GGGTGAACAGGCTCCAGGGGAGG + Intronic
1182944687 22:34310830-34310852 GAGCCAATAGTTTCCAGGGTTGG - Intergenic
1183041111 22:35178646-35178668 GAGTCAGCAGTGCCCTGGGTGGG - Intergenic
949667881 3:6362386-6362408 GAGTAAACAGTCTACAGAATGGG + Intergenic
950200717 3:11041198-11041220 GAGTAAACATTTTCCAGGCTAGG + Intergenic
950680882 3:14584376-14584398 GAGTCAGGAGCCTCCACGGTGGG - Intergenic
951046446 3:18044422-18044444 CAGGCTCCAGTCTCCAGGGTAGG - Intronic
951207253 3:19937904-19937926 GAGCTAACAGTCTTCAGGGGAGG - Intronic
951310715 3:21123384-21123406 GAGTAAACAGTCTACAGAATGGG - Intergenic
953288090 3:41632871-41632893 GAGTCCACATTCTACAGGGTAGG + Intronic
954799811 3:53180748-53180770 GATTGGACAGTCTCGAGGGTGGG - Intronic
955282365 3:57605383-57605405 GAGGAAACATTGTCCAGGGTTGG + Intergenic
956366578 3:68509896-68509918 GAGGCAACTGGCTCCAGAGTGGG + Intronic
957934578 3:86926018-86926040 GAGACAACACCCTCCAAGGTTGG - Intergenic
959252298 3:103964384-103964406 GAGTAAACAGCCTACAGGGTGGG + Intergenic
959686448 3:109152498-109152520 AAGTCCAAAGTCTTCAGGGTGGG + Intergenic
960190192 3:114694982-114695004 GCATCAGCAGTCTGCAGGGTTGG + Intronic
962984926 3:140527136-140527158 GAGTAAACAGCCTACAGGATGGG + Intronic
967254535 3:187576223-187576245 GAATGTCCAGTCTCCAGGGTAGG - Intergenic
968451770 4:679280-679302 GAGGCAGCAGGCTCCAGGGAGGG + Intronic
968464310 4:742865-742887 GAGTCCACAGCCTGCAGGGAGGG - Intronic
969197137 4:5571996-5572018 GAGTCCAAATTCTGCAGGGTTGG - Intronic
970601986 4:17647852-17647874 GGGACAACAGTCTCTGGGGTGGG + Intronic
982104863 4:152003021-152003043 GAGTCATGAATTTCCAGGGTAGG - Intergenic
982214221 4:153066319-153066341 AAGTCCAAAGTCTGCAGGGTAGG - Intergenic
984790773 4:183612668-183612690 GAGCCCACAGTCCGCAGGGTAGG - Intergenic
985214681 4:187638414-187638436 GAGTAAACAGCCTGCAGGATGGG - Intergenic
985433409 4:189903554-189903576 GAGTCCACAGTCTGATGGGTAGG - Intergenic
986627854 5:9739342-9739364 GTGTCAACAGTCTCCAGGACAGG + Intergenic
986630574 5:9768152-9768174 GAGTGCACAGTCTCCAGAGAGGG - Intergenic
987189704 5:15463543-15463565 AAGTTAACAGTTTCCAGGGCTGG + Intergenic
988285622 5:29212593-29212615 GAGTCAAGAATCACCAGGGTGGG + Intergenic
989526425 5:42458693-42458715 GAGTAAACAGCCTACAGGATGGG + Intronic
989610029 5:43281999-43282021 GAGACAGCAGCCTGCAGGGTTGG - Intergenic
995652232 5:114382788-114382810 GAGTGGCCAGTTTCCAGGGTTGG - Intronic
996073971 5:119167252-119167274 GAGACTAAAGTCTCCAGGGGCGG + Intronic
1000403498 5:160859724-160859746 TAGTCACCAGTCACCAGTGTTGG - Intergenic
1002269796 5:178063386-178063408 AAGTCAACAGTATCCTGTGTTGG + Intergenic
1006258345 6:32848732-32848754 GAGTCAACAGACCACTGGGTGGG + Exonic
1007164268 6:39817659-39817681 AAGTCAAAAATCTGCAGGGTAGG + Intronic
1013231191 6:108163744-108163766 GCGGCAACAAGCTCCAGGGTAGG - Intronic
1015582997 6:134746600-134746622 GAGTCTCCAGTCTCTAAGGTTGG - Intergenic
1016413359 6:143807116-143807138 GAGTCGACAGTTTACAAGGTAGG + Exonic
1019928554 7:4208745-4208767 TAGTGAGCAGTCTCCAGGGGTGG - Intronic
1020272465 7:6605551-6605573 GAGTCAAGAGTCTCCAGGGCAGG - Intronic
1021566898 7:22025023-22025045 GAGACAACAGTGTCTAGTGTAGG + Intergenic
1022792832 7:33705687-33705709 GGGGCAAGAGTCCCCAGGGTAGG + Intergenic
1028551171 7:92068062-92068084 AAGTTATCAGTCTCCAGGGCTGG + Intronic
1028987065 7:97017211-97017233 GAGTGGACAGGCTCCCGGGTGGG + Intergenic
1029514602 7:101017631-101017653 GAGTCAACAGTCTCCAGGGTGGG - Exonic
1029872896 7:103714492-103714514 GAGTCAACGGTCTGCCTGGTTGG + Intronic
1030261884 7:107574366-107574388 GAGACAAGAGTTTCCCGGGTTGG + Intronic
1032440009 7:131935384-131935406 GAGTCAACAGTCAGCAGGTGTGG - Intergenic
1035743251 8:1944526-1944548 GAGTCAGCAGTCTCCACCATGGG + Intronic
1036167165 8:6446885-6446907 GCGTCGACAGCCTCCGGGGTTGG + Intronic
1036237371 8:7051946-7051968 AAGTCAACAATCTTCAGGATGGG - Intergenic
1037839976 8:22237791-22237813 GAGTCAAGAGTCGCAAGGCTGGG + Intergenic
1041952751 8:63522466-63522488 GAATCAACAGTCTTCAAGGTAGG - Intergenic
1043857015 8:85275414-85275436 GAGTCAACAGTGGCCATGGTAGG - Intronic
1044867646 8:96587944-96587966 CAGGCAACAATCTCCTGGGTAGG + Intronic
1045381974 8:101636317-101636339 GAGTCAACAGTCTTCAGGCCAGG - Intronic
1046921502 8:119734120-119734142 ATGTCAACAGTGTCCAGGCTGGG + Intronic
1048805538 8:138237795-138237817 AAGTCTAAAGTCTACAGGGTAGG - Intronic
1049281079 8:141745160-141745182 TAGTCAGGATTCTCCAGGGTAGG - Intergenic
1050657927 9:7849477-7849499 GAATCTAAGGTCTCCAGGGTAGG - Intronic
1053017434 9:34670689-34670711 GAGCCATCAGTCTCAAGGCTGGG + Intergenic
1055058368 9:72044300-72044322 AAGTCCAAAGTCTGCAGGGTAGG + Intergenic
1058138737 9:101336162-101336184 GAGTCAAGGCTCTCCAGGGTTGG + Intergenic
1060011320 9:120045068-120045090 GAGTAAAAAATCTCGAGGGTTGG - Intergenic
1186023021 X:5277861-5277883 GAGTCTAAAGTCACCAGGATGGG - Intergenic
1190172099 X:48119829-48119851 GAGCCCACAGCATCCAGGGTAGG - Intergenic
1190816118 X:53931373-53931395 GAGCTAACAGTCTTCAGGGGAGG - Intergenic
1196759264 X:119186809-119186831 GACTGAACAGTCTCCATGTTTGG + Intergenic
1196892295 X:120302806-120302828 TAGGCAACAGGCTCCAGGCTTGG + Intronic
1202069755 Y:20978709-20978731 GAGACTACAGTCTTCAGGGAGGG - Intergenic