ID: 1029516414

View in Genome Browser
Species Human (GRCh38)
Location 7:101026191-101026213
Sequence GTGGAGTGAAGGTGCTCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029516401_1029516414 19 Left 1029516401 7:101026149-101026171 CCCACCTCTTAGGGGTCAGTGGA 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516402_1029516414 18 Left 1029516402 7:101026150-101026172 CCACCTCTTAGGGGTCAGTGGAT 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516398_1029516414 26 Left 1029516398 7:101026142-101026164 CCCTCTTCCCACCTCTTAGGGGT 0: 1
1: 0
2: 2
3: 22
4: 198
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516409_1029516414 -10 Left 1029516409 7:101026178-101026200 CCTACCGGGCACAGTGGAGTGAA 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516403_1029516414 15 Left 1029516403 7:101026153-101026175 CCTCTTAGGGGTCAGTGGATCAG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516399_1029516414 25 Left 1029516399 7:101026143-101026165 CCTCTTCCCACCTCTTAGGGGTC 0: 1
1: 0
2: 3
3: 21
4: 181
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516394_1029516414 29 Left 1029516394 7:101026139-101026161 CCACCCTCTTCCCACCTCTTAGG 0: 1
1: 0
2: 2
3: 35
4: 453
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029516414 Original CRISPR GTGGAGTGAAGGTGCTCACG GGG Intronic
903666633 1:25011968-25011990 ATGGAATGAAGATGCTGACGGGG - Intergenic
906345969 1:45014593-45014615 GTTGAGTGAAGGTGGTCCTGTGG + Intronic
907342648 1:53747914-53747936 GTGGAGAGCAGGTGCTCAGAAGG - Intergenic
907385544 1:54123081-54123103 GCAGAGTGAAGGAGCTCACAGGG - Intergenic
909121996 1:71615063-71615085 GTGGAGAGAAGATTCTCATGAGG + Intronic
914855475 1:151347210-151347232 CTGGAGTGAAGGTGGCTACGAGG - Exonic
917460236 1:175223072-175223094 GTGGAGTGATGGAGCTGAAGTGG - Intergenic
918971005 1:191418981-191419003 GATGAGGGAAGGTGCTCATGAGG - Intergenic
920651914 1:207844048-207844070 GTGGTGTGAAGGTGCTCCCAGGG - Intergenic
922567180 1:226608340-226608362 CTGGGGTGACGGTGCCCACGAGG - Exonic
1067088791 10:43256182-43256204 GTGGAGTGAGGATGCTGAGGGGG + Intronic
1073108670 10:101047976-101047998 GTGGAGTGGGGGAGCTCACCTGG - Intergenic
1075048933 10:119167360-119167382 GTGGAGTGAAACTGCTGAAGCGG - Intergenic
1075872097 10:125778363-125778385 GTGCAGTGCAGGAGCCCACGGGG - Intergenic
1076298348 10:129404706-129404728 CTGGACTGAAGGTGCTTACGCGG + Intergenic
1076854231 10:133108072-133108094 GTGGAGTGGATGTGGGCACGAGG + Intronic
1078355724 11:10630126-10630148 CTGGAGGGAAGGTGGCCACGGGG - Intronic
1080008288 11:27432248-27432270 GGGGAGAGAAGGTGTTCAAGTGG - Intronic
1084266190 11:68006550-68006572 GTGGTGTGAAGGGAATCACGTGG - Intergenic
1089678288 11:120105267-120105289 GTGGAGTGAAGATAGTGACGTGG - Intergenic
1089849347 11:121482836-121482858 GGGGAGAGAAGGTGCTAGCGCGG + Intronic
1093708037 12:22296875-22296897 GTGGAGTATAGGTGTTCATGTGG - Intronic
1097489076 12:60241793-60241815 GTGGAGTGAAGGTGGTCTTGGGG - Intergenic
1100084091 12:90886400-90886422 AGGGAGTGAATGTGCTCAGGAGG - Intergenic
1105940198 13:25141022-25141044 GAGGAGTGAGGGTCCTCACAGGG - Intergenic
1106715084 13:32380040-32380062 CTGAAGTGAAGGGGCTCCCGTGG - Exonic
1113657021 13:112073423-112073445 GTGGAGAGAAAGTGCTGACCCGG + Intergenic
1114578439 14:23734672-23734694 GTAGAGAGAGGGTGCTCACAGGG + Intergenic
1121598511 14:95185125-95185147 GAAGAGGGCAGGTGCTCACGTGG + Exonic
1123931433 15:25173497-25173519 GGGGAGTGGAGGTGCTCCAGGGG + Intergenic
1123933670 15:25183852-25183874 GTGTAGTGGAGGTGCTCGTGTGG + Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1125606846 15:40944315-40944337 GAGAAGTCAAGGTGCTCACAAGG - Intergenic
1126315318 15:47363603-47363625 GTGGAATGAAAGTGCTGACCAGG + Intronic
1136297865 16:29313906-29313928 GTGGAGTAAAGCAGGTCACGAGG + Intergenic
1137724198 16:50646095-50646117 GTGGAGACAAGATGCTAACGGGG + Intergenic
1141259604 16:82440623-82440645 GGGGAGTGAAGGTCCTGAGGAGG - Intergenic
1141321257 16:83011376-83011398 GGGGATTGAATGTGCTCATGAGG - Intronic
1143622208 17:8087173-8087195 GAGGGGTGAAGGTGCGCAGGGGG - Intronic
1151215046 17:72571566-72571588 GTGGGGTGAAGGCACTCACGGGG - Intergenic
1151426654 17:74035101-74035123 GTTAAGTGAAGGTGCCCAGGTGG + Intergenic
1157515308 18:48306987-48307009 GTGGAGGGAAGGTGGTAAGGAGG - Intronic
1157543750 18:48533078-48533100 CTGGAGTACAGGTGCTCACCAGG + Intergenic
1158686537 18:59620145-59620167 CTGGAGTCAAGGCTCTCACGTGG - Intronic
1159891380 18:73956195-73956217 GTGGAGCCAATGTACTCACGAGG - Intergenic
1162549806 19:11352032-11352054 GTGGAGGGAGGGGGCTCAGGCGG - Intronic
1162765026 19:12913991-12914013 GTGGAATGAATGAGCTCACCTGG - Intronic
1164402694 19:27912476-27912498 GTGGAGTGAAGAGGCCCAGGTGG - Intergenic
1166309714 19:41956165-41956187 TTGGAGAGAAGGTGCTCTTGTGG + Intergenic
1167640667 19:50679477-50679499 GTGGAGTTCAGGTGCTCCCTGGG - Intronic
1167768316 19:51499011-51499033 GTGATGAGAAGGTGCTCAGGTGG + Intronic
1167884948 19:52492838-52492860 TTGGAGTGAAGGTCCTACCGCGG + Intronic
1167890514 19:52536021-52536043 GTGGAGTGAAGGTCGTACCGCGG + Intronic
1167892236 19:52549805-52549827 TTGGAGGGGAGGGGCTCACGGGG - Intronic
1167912059 19:52711773-52711795 TTGGAGGGGAGGGGCTCACGGGG + Intronic
1167914025 19:52725725-52725747 GTGGAGTAAAGGTCCTACCGAGG - Intronic
1167919728 19:52773034-52773056 TTGGAGGGGAGGGGCTCACGGGG + Intronic
1167921542 19:52786734-52786756 GTGGAGTGAAGGTCCTACCACGG - Exonic
1167927169 19:52830703-52830725 TTGGAGGGGAGGGGCTCACGGGG + Intronic
1167931433 19:52868936-52868958 TTGGAGGGGAGGGGCTCACGGGG + Intronic
1167999289 19:53432003-53432025 GTGGAGTGACGGTGCCACCGCGG + Intronic
925203468 2:1987653-1987675 GGGGAGTGCAGGTGCTCCCTGGG + Intronic
927465632 2:23334347-23334369 GTGGTTTAAAGGTGCTCAGGGGG + Intergenic
928314947 2:30237800-30237822 GTTAAGTGAATGTGCACACGTGG - Intronic
929907264 2:46057130-46057152 GGGCAGTCAAGCTGCTCACGTGG + Intronic
935194903 2:100807462-100807484 GAGGAGAGAAGGTGGTCAGGTGG + Intergenic
937247556 2:120503384-120503406 GTGGAATGAGGGTGACCACGTGG - Intergenic
937326323 2:120991555-120991577 GAGGAGTGAGGGTGCACCCGGGG + Exonic
938319505 2:130353724-130353746 TTGGAGTGAGGGTGAACACGAGG + Intergenic
942054785 2:172172525-172172547 GAGGAGGGAAGCTGCTCCCGCGG + Intergenic
944869633 2:203896917-203896939 GTGGAGAGAAGGTACTCCAGAGG + Intergenic
946244996 2:218382414-218382436 GTGGAGTGGAGGAGATCACTAGG + Intronic
946827988 2:223698512-223698534 GTGGAGAGAAGGTAGTCATGGGG - Intergenic
948852346 2:240714595-240714617 CTGGTGTGGAGGTGCTCATGGGG - Exonic
1168958038 20:1848495-1848517 CAGGAGTGAAGCTGCTCACCTGG + Intergenic
1170840699 20:19922702-19922724 GTGGAATGAAAGTGCCCATGGGG + Intronic
1171360771 20:24585019-24585041 GTGGTGTGCAGGTGTTCACAGGG + Intronic
1175656118 20:60772624-60772646 GTGGAGAGAAGGTGCTCCCAGGG - Intergenic
1179800367 21:43808838-43808860 GTGGAGCGTTGTTGCTCACGTGG - Intergenic
1184460713 22:44636379-44636401 GTGGAGTGGAAGGGCTCAGGAGG + Intergenic
951047819 3:18061003-18061025 ATGGGGTGAAGGAGCTCATGAGG + Intronic
956346725 3:68287559-68287581 GTGGTGAGAAGGTTCTCACAGGG - Intronic
958900082 3:99876043-99876065 GTGGAGCGAAGTTGCTCTCCCGG + Intronic
962317460 3:134367667-134367689 GTGGACTGAGGGAGCTCAGGGGG + Exonic
964411325 3:156400757-156400779 GTGGAGAGAAGGTGTTCACTAGG - Intronic
966596480 3:181728502-181728524 TTGGTGTGAAGGTGCTGAGGGGG - Intergenic
966621051 3:181964488-181964510 CTGGAGTCAAGGTGCACAGGCGG + Intergenic
982239616 4:153285890-153285912 GTGTACTGAAGGTGCTGACCAGG - Intronic
994568876 5:101487314-101487336 GTGGAGTGATGGTTCCCATGAGG - Intergenic
996741064 5:126799393-126799415 GTGGAGTTAAAGGGCTCACAAGG + Intronic
997370211 5:133354806-133354828 GTGGAAAGATGGTGCTCCCGGGG - Intronic
1002259316 5:177982957-177982979 GTGGAGGGAAGGTGGTCTTGGGG + Intergenic
1011919794 6:92559209-92559231 GTAGAGAGAAGCTGCTCACATGG - Intergenic
1015662006 6:135586249-135586271 GTGGAGTGAATATTCTCATGAGG + Intergenic
1018910450 6:168098449-168098471 GTGGACTGAAGGAGCCCACCCGG + Intergenic
1026849656 7:73717002-73717024 GGGGAGTGAAGGGGGTCACTGGG - Intronic
1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG + Intronic
1030065036 7:105652891-105652913 GGGGAGGGAAGGTGCTCCTGAGG - Intronic
1031481737 7:122286042-122286064 GTTGAGTGAAGATGTTAACGTGG - Intergenic
1032470902 7:132178297-132178319 GTGGGGTGAAGGTGCTCTAGTGG + Intronic
1035425248 7:158766892-158766914 GTGGAGTGAAGGATCTCTCATGG - Intronic
1037285663 8:17296251-17296273 GTGGAGGGCAGGTATTCACGTGG + Exonic
1037294954 8:17390266-17390288 GGGGAGTGAAGCTTCTCACATGG + Intronic
1045223205 8:100218426-100218448 GTGAAGTGAAGGTAGTCACATGG + Intronic
1045898915 8:107251644-107251666 TTGGGGTGACAGTGCTCACGTGG - Exonic
1047124532 8:121945975-121945997 GTGGACTGAATGTGATCACAAGG - Intergenic
1052895331 9:33742276-33742298 GTGGAGTGAAGTTCCTCAGAAGG - Intergenic
1057311907 9:93948242-93948264 GCCGAGTGAAGGTGCTCACTCGG + Intergenic
1060583520 9:124771688-124771710 GGGGCTTGAAGGTACTCACGTGG + Intergenic
1188773516 X:34184872-34184894 CTGTAGTCAAGGTGCTCACCAGG - Intergenic
1189757191 X:44283501-44283523 GTGGAGTCAAAGTGCTTCCGGGG - Intronic
1190049625 X:47140176-47140198 GTGGAGAGAATGTGCTCTCTAGG + Intergenic