ID: 1029516414

View in Genome Browser
Species Human (GRCh38)
Location 7:101026191-101026213
Sequence GTGGAGTGAAGGTGCTCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029516409_1029516414 -10 Left 1029516409 7:101026178-101026200 CCTACCGGGCACAGTGGAGTGAA 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516403_1029516414 15 Left 1029516403 7:101026153-101026175 CCTCTTAGGGGTCAGTGGATCAG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516394_1029516414 29 Left 1029516394 7:101026139-101026161 CCACCCTCTTCCCACCTCTTAGG No data
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516401_1029516414 19 Left 1029516401 7:101026149-101026171 CCCACCTCTTAGGGGTCAGTGGA No data
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516398_1029516414 26 Left 1029516398 7:101026142-101026164 CCCTCTTCCCACCTCTTAGGGGT 0: 1
1: 0
2: 2
3: 22
4: 198
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516399_1029516414 25 Left 1029516399 7:101026143-101026165 CCTCTTCCCACCTCTTAGGGGTC 0: 1
1: 0
2: 3
3: 21
4: 181
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1029516402_1029516414 18 Left 1029516402 7:101026150-101026172 CCACCTCTTAGGGGTCAGTGGAT No data
Right 1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029516414 Original CRISPR GTGGAGTGAAGGTGCTCACG GGG Intronic