ID: 1029519590

View in Genome Browser
Species Human (GRCh38)
Location 7:101051716-101051738
Sequence GGAGAGGTGGGGAGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1013
Summary {0: 1, 1: 0, 2: 8, 3: 129, 4: 875}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029519573_1029519590 28 Left 1029519573 7:101051665-101051687 CCAGTACGACCCTGAAGGTAGGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG 0: 1
1: 0
2: 8
3: 129
4: 875
1029519574_1029519590 19 Left 1029519574 7:101051674-101051696 CCCTGAAGGTAGGTGATAACACA 0: 1
1: 0
2: 0
3: 4
4: 134
Right 1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG 0: 1
1: 0
2: 8
3: 129
4: 875
1029519571_1029519590 29 Left 1029519571 7:101051664-101051686 CCCAGTACGACCCTGAAGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG 0: 1
1: 0
2: 8
3: 129
4: 875
1029519575_1029519590 18 Left 1029519575 7:101051675-101051697 CCTGAAGGTAGGTGATAACACAA 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG 0: 1
1: 0
2: 8
3: 129
4: 875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029519590 Original CRISPR GGAGAGGTGGGGAGCCCAGG AGG Intronic
900144526 1:1152161-1152183 GGAGAGGTGACGAGGCCACGGGG - Intergenic
900428561 1:2591665-2591687 GGCGTGGTGGGGTGGCCAGGAGG + Intronic
900547626 1:3237348-3237370 GTGGGGGTGGGGAGCCCAGGAGG - Intronic
900589042 1:3451442-3451464 ACAGAGTTGGGGAGCCAAGGAGG - Intergenic
900641565 1:3690247-3690269 GGAGAGGAGGGGCTCACAGGAGG - Intronic
900942015 1:5805127-5805149 GGAGTGGTGAGGAGGCCACGTGG - Intergenic
900951494 1:5860477-5860499 GGATGGGTGGGCTGCCCAGGTGG + Intergenic
900963400 1:5940177-5940199 TGAGAGGTGGTGAGGCCATGAGG + Intronic
900984652 1:6066313-6066335 GGGGAGTTGGGGAGGCCGGGAGG - Intronic
901167279 1:7229580-7229602 GGAGAGGAGGGGAGGGCAGGAGG + Intronic
901192369 1:7420229-7420251 GGAGAGGTGGGGGAGCCAGGCGG - Intronic
901320683 1:8338263-8338285 GGCGAAGTGGGGGGCCCTGGGGG + Intronic
901633021 1:10657022-10657044 AGACAGGTGGGCAGCCGAGGGGG - Intronic
901652586 1:10751762-10751784 TGGGAGGAGGGCAGCCCAGGGGG + Intronic
901794417 1:11672186-11672208 AGGGTGGTGGGGAGGCCAGGAGG - Intronic
901795130 1:11675470-11675492 GGGGCAGTGAGGAGCCCAGGTGG - Intronic
901919471 1:12525954-12525976 GGAGAGGTGGGGATCAGACGGGG + Intergenic
902053867 1:13584336-13584358 TGCGAGGTGGGCAGCACAGGGGG + Intronic
902392727 1:16115752-16115774 GGTGAGGAGGAGAGCCCTGGGGG - Intergenic
902450106 1:16491345-16491367 GGAGAGGAGGGAAGCAGAGGTGG + Intergenic
902466530 1:16621975-16621997 GGAGCAGTGGGCAGCCCAGGAGG - Intergenic
902625741 1:17675301-17675323 GGGGAGGTGGGGAGGCCACAGGG - Intronic
902629050 1:17694009-17694031 GGAGAGGCTGGGAGTGCAGGGGG - Intronic
902637343 1:17743296-17743318 GGAGAGGCGGGGAGGGGAGGGGG + Intergenic
902862854 1:19258365-19258387 GGAGCCGTGGGGAGGGCAGGTGG + Intronic
903004952 1:20292349-20292371 GAAGAGGTGGTGAGGCCACGAGG + Intronic
903016720 1:20366443-20366465 GAAGATGCGGGGAGCCCAGGCGG - Intergenic
903715328 1:25361620-25361642 GCAGAGGTGGGGAGCCTGGGGGG - Exonic
903905665 1:26684265-26684287 GGAGGGTTGCTGAGCCCAGGAGG + Intergenic
904202064 1:28826424-28826446 TGAGATGGGTGGAGCCCAGGAGG + Intronic
904286251 1:29454843-29454865 GGGGAGGTGGGGCTCCCAGATGG - Intergenic
904396237 1:30224413-30224435 GAAGAGCTAGGGAGCCCAGTGGG - Intergenic
904417989 1:30374537-30374559 GGGGAGGTGGGGCTCCCAGATGG + Intergenic
904461969 1:30685738-30685760 GGTGAGGTGGGGAGGGCAGCAGG - Intergenic
905051152 1:35052368-35052390 TGAGAGCTGGGGATCCCAGGAGG + Intergenic
905308951 1:37036550-37036572 GTAGAGGTGTGGCTCCCAGGAGG + Intergenic
905329859 1:37186982-37187004 AGAGAGGTCAGGAGCTCAGGTGG - Intergenic
905484526 1:38285977-38285999 GGAGGGGAGGGGAGAGCAGGGGG + Intergenic
905927338 1:41760826-41760848 GGAAGGCTGGGGAGACCAGGTGG - Intronic
906077605 1:43063547-43063569 GCAGAGGTGGGCAGCCTGGGAGG - Intergenic
907135784 1:52138520-52138542 GCCGAGGTGGGCAGCCCACGAGG - Intergenic
907328931 1:53658898-53658920 GGGGAGGTGGGGGGCACAGCAGG + Intronic
908262472 1:62349563-62349585 GGAGAAGTGGGGAGGGGAGGGGG + Intergenic
909393072 1:75136982-75137004 GGTGGGGTGGGGTGGCCAGGGGG + Intronic
911449879 1:98049083-98049105 GGAGAGGGAGGGAGTCAAGGGGG - Intergenic
911702791 1:100974038-100974060 GCGGAGATGGGGAGCCCAGAAGG + Intronic
912453011 1:109778888-109778910 TCAGAGGAGGGGAGCCCTGGAGG - Intergenic
912812684 1:112805768-112805790 GGGGAGGTGGTGAGCACAGGAGG + Intergenic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
913328012 1:117644555-117644577 GGAGAGATGGGAAGCAAAGGAGG - Intergenic
914350762 1:146837866-146837888 TGAGAGGAAGGGAGCTCAGGTGG - Intergenic
915333471 1:155127735-155127757 GGCGGGGTGGGGAGGCGAGGAGG - Exonic
915772673 1:158445277-158445299 TGTGAGGTGGGAAGCACAGGTGG + Intergenic
915783360 1:158579114-158579136 GGTGAGGTGGGAGGCACAGGTGG + Exonic
915797436 1:158751996-158752018 GCATAGGAGGGAAGCCCAGGGGG - Intergenic
915944711 1:160141348-160141370 GGAAAGATGGGGAGCTCTGGAGG + Exonic
916058180 1:161082236-161082258 GGAGAACTGGTGAACCCAGGAGG + Intronic
916172208 1:162009799-162009821 GGAGAGGTGGGGAGCTCTTGAGG - Intronic
917424410 1:174899278-174899300 GGAGAGCTCAGGAGCTCAGGAGG + Intronic
919172823 1:193977363-193977385 GAAGAGCTGGGTAGCCCAGGAGG - Intergenic
920054203 1:203180917-203180939 GGAGAGGCTGGGAGCCGAGGAGG - Intronic
920244534 1:204577843-204577865 GGAGAATTGAGGAGCCCGGGAGG - Intergenic
920309686 1:205041791-205041813 GGAAAGGAGGGGAGCGCATGTGG + Intergenic
921228337 1:213043182-213043204 GGGGAGGTGGGGAGGTGAGGAGG + Intergenic
921825772 1:219670429-219670451 GGAGAGGTGGGAAGTCCTGCCGG - Intergenic
921826006 1:219672723-219672745 GGAGAGGTGGGAAGTCCTGCCGG - Intergenic
922501262 1:226098624-226098646 GGGGAGATGGGGAGGGCAGGGGG - Intergenic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
922861107 1:228817245-228817267 GGAGAAGTGAGAAGGCCAGGAGG + Intergenic
923583215 1:235238763-235238785 GGAGAATTGTTGAGCCCAGGAGG + Intronic
1062760032 10:11291-11313 GGGGAGGTGGGGGGCCTAGGAGG - Intergenic
1063346598 10:5317911-5317933 GGACACGTGGGGGGCCCAGATGG + Intergenic
1063372808 10:5532776-5532798 GGAGAGGAGAGGAGGCCATGTGG - Intergenic
1063427089 10:5958961-5958983 AGAGAGGAGGGGAGAACAGGAGG - Intronic
1064112342 10:12550066-12550088 GGAGCGAGGGGCAGCCCAGGAGG + Intronic
1064114759 10:12568313-12568335 GGAGGGGTGGGGAGAGGAGGTGG - Intronic
1064114782 10:12568362-12568384 GGAGAGGAGGGGAGAGGAGGGGG - Intronic
1064384326 10:14877909-14877931 GGAGGGGGGTGGAGACCAGGTGG + Intergenic
1064732453 10:18346594-18346616 GGGGAGGAGGGGAGCTCGGGGGG + Intronic
1065656739 10:27959218-27959240 GGAGGGGAGGGGAGGCGAGGAGG + Intronic
1066055832 10:31679099-31679121 GAAGAGGTGGGGAGCGCTGGGGG + Intergenic
1067329693 10:45303631-45303653 GGTGAGGTGGGAAGAGCAGGTGG + Exonic
1067559243 10:47293286-47293308 GGAGAGGCTGGGACCTCAGGAGG - Intergenic
1067684493 10:48458420-48458442 GGAGAGCAGGTGTGCCCAGGTGG + Intronic
1067691660 10:48505738-48505760 GGAGAGAGGGGTAGGCCAGGAGG + Intronic
1068652163 10:59534458-59534480 GGAGAGGTGGTGAGGACAGATGG + Intergenic
1068712183 10:60147339-60147361 GGAGAGGTGGAGAGTGAAGGGGG - Intronic
1068984525 10:63094857-63094879 GGAGAGGCAGGGAGACCAGCTGG + Intergenic
1069474020 10:68717525-68717547 GGAGAGGAGGGGAGGGGAGGGGG - Intergenic
1069581969 10:69572553-69572575 GGGGAGCTGGGCAGCCCAGGCGG - Exonic
1069752570 10:70753760-70753782 GGAGAGGAGGTGAGACCAAGGGG - Intronic
1069787625 10:70998739-70998761 GTAGAGCTGGTCAGCCCAGGAGG - Intergenic
1069895643 10:71678669-71678691 GGAGTGGTGGGGACCACTGGAGG + Intronic
1070274968 10:74997217-74997239 GGGGGGGTGGGGAGAACAGGGGG - Intronic
1070626574 10:78055138-78055160 AGAGAGATGTGGAGCCCTGGAGG - Exonic
1070657842 10:78283408-78283430 GGACAGCTGCGGAGGCCAGGAGG + Intergenic
1070668553 10:78362347-78362369 GGAGGTGTGGGCTGCCCAGGTGG - Intergenic
1070673669 10:78397210-78397232 GGAGAGCTGGGGAGGACAGTAGG + Intergenic
1070729294 10:78814158-78814180 GGAGAGGTGGTGAGCACTGGAGG + Intergenic
1070768609 10:79069973-79069995 GGCCAGGAGGGGAGCCCAGGGGG + Intronic
1070892143 10:79948913-79948935 CAGGAGGTGGGGAGCACAGGAGG - Intronic
1071270191 10:84000011-84000033 GGAGAGGTGGTGAGGGCAGAAGG - Intergenic
1072083613 10:92057155-92057177 CTAGAGTTGGGGACCCCAGGAGG - Intronic
1072623519 10:97096410-97096432 AGAGTGGTGGGGAGGGCAGGAGG - Intronic
1073147835 10:101292165-101292187 GGGAACGTGGGGAGCCCGGGAGG - Intergenic
1074228626 10:111512228-111512250 AGAGAGGAGAGGAGGCCAGGAGG - Intergenic
1074974643 10:118570103-118570125 GGAGAGGTTGAGTGCCCAGCTGG - Intergenic
1075410746 10:122226178-122226200 AGTGAGGTGGGGAGGCCAGGAGG - Intronic
1075633585 10:124015912-124015934 GGAGTGGTGACGAGCCCTGGTGG + Intronic
1075938495 10:126365615-126365637 GGAGAAGTGTGGAGCAAAGGGGG + Intronic
1076119133 10:127921856-127921878 GGGCAGGAGGGGAGTCCAGGAGG + Intronic
1076135763 10:128045047-128045069 GGTGGTGTGGGGAGGCCAGGTGG - Intronic
1076297365 10:129397179-129397201 GGAGAAGTGGAGAGGGCAGGAGG - Intergenic
1076333750 10:129691372-129691394 GGAGAGGCGGAGAGCACAGCAGG + Intronic
1076404247 10:130201639-130201661 GGAGATCTGGGGAGCTGAGGGGG + Intergenic
1076527802 10:131123392-131123414 GAAGAGGTGAGGAGCCCTGGGGG + Intronic
1076595588 10:131623037-131623059 GGAGAGGTGGGGAGAGGTGGGGG + Intergenic
1076798792 10:132811293-132811315 GGAGGCTGGGGGAGCCCAGGTGG - Intronic
1076821774 10:132943231-132943253 TGGGAGGTGGGGAGCCCCGGGGG - Intergenic
1076879489 10:133232851-133232873 GGAGAAGTGCTGAACCCAGGAGG + Intergenic
1077060087 11:614137-614159 GGGGAGGGGGGGAGCGCGGGAGG - Intronic
1077376031 11:2205474-2205496 TGGGAGGTGGGGAGCCTGGGAGG - Intergenic
1077376044 11:2205513-2205535 GGGGAGGTGGGGAGGCTTGGAGG - Intergenic
1077529766 11:3089754-3089776 CGGGAGGTGGGGAGGCCAGGAGG - Intronic
1077533352 11:3107510-3107532 CGAGGGGTGGGCAGCCCAGAGGG - Intronic
1077843180 11:5996944-5996966 GATGAGATGGGAAGCCCAGGAGG + Intergenic
1078030543 11:7746689-7746711 AGTGAGGTGGGAAGCGCAGGTGG - Intergenic
1078413454 11:11146768-11146790 GGGGAGGTGGTGAGCCCAGTGGG + Intergenic
1078456214 11:11477495-11477517 GGAAAGGTGTGGAGGGCAGGAGG - Intronic
1078662986 11:13302103-13302125 GGAGAGGTGGGGATGGGAGGAGG + Intronic
1079309295 11:19350182-19350204 TGAGAAGTGGGGAGCCCGTGAGG + Intergenic
1079965368 11:26973708-26973730 GTAGGGAAGGGGAGCCCAGGTGG - Intergenic
1080283680 11:30585670-30585692 GAAGAGGTGGGGACCCCCAGAGG + Intronic
1081002509 11:37692360-37692382 GGAGGGGAGGGGAGGACAGGAGG + Intergenic
1082652611 11:55812182-55812204 TGTGAGGTGGGAAGCACAGGTGG - Exonic
1082726469 11:56743029-56743051 GATGAGGTGGGAAGCACAGGTGG + Exonic
1082768366 11:57186461-57186483 GGGAAGATAGGGAGCCCAGGGGG + Intronic
1082868004 11:57917497-57917519 GGTGAGGTGGGAGGCACAGGTGG + Intergenic
1082997128 11:59263357-59263379 GGAAGGGTGGGGACCCCAGTGGG - Intergenic
1083172897 11:60933580-60933602 GGAGAGCCGGGGCGCCCGGGGGG + Exonic
1083309299 11:61776292-61776314 GGAGAGGCAGGGTGCTCAGGGGG - Intronic
1083429145 11:62604944-62604966 GAAGAGGAGGGGAGCCCGGGTGG + Intronic
1083664001 11:64265056-64265078 GGGGAGGTGGTGGGGCCAGGGGG - Exonic
1083727802 11:64637424-64637446 CTGGAGGTGGGGAGCCCAGTAGG + Intronic
1083827135 11:65210255-65210277 GGAGGGGTTGGGTCCCCAGGAGG - Intronic
1083882437 11:65555190-65555212 GGAGAGGCTGGAAGCCAAGGAGG - Intronic
1083933366 11:65857871-65857893 GTGGGGGAGGGGAGCCCAGGCGG + Intronic
1083940498 11:65892897-65892919 GGAGGGTTGGAGAGCCAAGGGGG + Exonic
1084020637 11:66415263-66415285 GGAGAGGTGGGAAGCCCAATGGG - Intergenic
1084188105 11:67486005-67486027 GGAGAGGTGGGGCCACCAAGTGG - Intronic
1084383298 11:68827013-68827035 GGTGAGGTGGGGTGTCCAGGTGG + Intronic
1084426136 11:69085448-69085470 GGAGAGGTGCGGAGCGGAGGTGG - Intronic
1084514244 11:69627588-69627610 GGAGAGGGAGGGATCCCACGTGG - Intergenic
1084669127 11:70595082-70595104 TGAGAGGTGGGGGGCCCTGCAGG - Intronic
1084939869 11:72606784-72606806 GGAGGGGTGGGTAGTCCATGGGG + Intronic
1085017615 11:73185673-73185695 GGAGTGGAGGGGCACCCAGGTGG - Intergenic
1085020169 11:73201633-73201655 GGGGACCTGGGGAGCCCATGTGG + Intergenic
1085034887 11:73293755-73293777 GGAGGGGAGGGGGTCCCAGGAGG + Intronic
1085339432 11:75721739-75721761 GAAGAGGTAGGGTTCCCAGGCGG - Intronic
1085403213 11:76246712-76246734 TGGGGGGTGGGAAGCCCAGGTGG + Intergenic
1085478247 11:76801399-76801421 GGCAAGGTGGGGAAACCAGGGGG - Intergenic
1085641179 11:78193918-78193940 AGGGTGGTGGCGAGCCCAGGAGG - Intronic
1086211963 11:84331589-84331611 GGAGAGGTGGGGCGGCCGGGTGG + Intronic
1086960117 11:92972737-92972759 GCAGCAGTGGTGAGCCCAGGAGG - Intronic
1087014655 11:93543339-93543361 GGCGAGGCGGGGAGCGCAAGCGG - Exonic
1088752576 11:112856871-112856893 GAAGTGTTGGGGAGCCTAGGAGG + Intergenic
1088801669 11:113312726-113312748 GGAGACCTGGGGATCCCAGCAGG - Intergenic
1088968911 11:114754310-114754332 GGAGAGGCAGGGAACACAGGTGG - Intergenic
1088978139 11:114834104-114834126 GGAGAGCTGGGGCTTCCAGGAGG - Intergenic
1089195935 11:116694038-116694060 TGAGAGGCGGGGAGCCCTGCTGG - Intergenic
1089270631 11:117299516-117299538 GGGGATGTGAGGAGGCCAGGAGG - Intronic
1089344996 11:117785372-117785394 GGATAGGTGGGGTGACAAGGGGG + Intronic
1090404001 11:126466462-126466484 ACAGAGCTGGGGGGCCCAGGGGG + Intronic
1090423682 11:126592689-126592711 GCCAGGGTGGGGAGCCCAGGAGG + Intronic
1090703547 11:129316546-129316568 GGGGAGGTGGAGGCCCCAGGGGG - Intergenic
1090704476 11:129324156-129324178 CGAGCAGTGGGGAGCCCATGAGG + Intergenic
1090744926 11:129697688-129697710 GGAGAGGTGGGGAGAAAAGAGGG + Intergenic
1091041469 11:132285135-132285157 TGAGAGAGGGGGAGTCCAGGTGG - Intronic
1091669221 12:2440526-2440548 GCATAGGTGGAGATCCCAGGAGG + Intronic
1091916765 12:4275468-4275490 GGAGAGGTGGGGAAGAGAGGGGG - Intronic
1092197834 12:6560602-6560624 GGAGGAGAGGGGAGCCCAGAGGG + Intronic
1092256267 12:6928136-6928158 GGGGAGGTGGGGAGCAGAGCGGG + Intronic
1092921185 12:13233137-13233159 GGAGAGGAGGGGAGGGGAGGGGG - Intergenic
1093091302 12:14924032-14924054 GGAAAGCTGGGGAGCGGAGGGGG - Intronic
1094383950 12:29873393-29873415 GGAGAGGAGGGGAAGACAGGAGG + Intergenic
1095410394 12:41914898-41914920 GGAGAAGTGGAGAGCTAAGGTGG - Intergenic
1095962109 12:47842182-47842204 GCTGAGGTGGAGAGCCCAGCAGG + Intronic
1096071472 12:48777792-48777814 GGCGATGTGGAGAGACCAGGAGG - Intronic
1096111556 12:49031918-49031940 GTTGAGGTTGGCAGCCCAGGAGG + Exonic
1096230557 12:49894484-49894506 GGGGAGGCTGGCAGCCCAGGGGG + Intronic
1096241585 12:49962683-49962705 GGAGAGGTGAGGGGCCCAGGAGG - Intronic
1096277783 12:50225356-50225378 GGAGAGGTGGGGAGTCAAGTAGG - Intronic
1096648951 12:53052676-53052698 GGAGGGCTGGCCAGCCCAGGCGG + Intronic
1096725014 12:53554496-53554518 TGAGGTGGGGGGAGCCCAGGAGG + Intronic
1097025552 12:56052710-56052732 GTGGAGGTGGGAGGCCCAGGCGG - Intergenic
1097402635 12:59148157-59148179 GGAGAAGTGGTGAGCAAAGGGGG - Intergenic
1097663615 12:62456334-62456356 GGAGAAGTGGGTAGACAAGGAGG - Intergenic
1097901900 12:64881776-64881798 AGAGAGGTGGGGTGGGCAGGGGG - Intergenic
1097990253 12:65825576-65825598 GGGGAGGTGGGGAGCCGCGGCGG + Intronic
1098444557 12:70552840-70552862 GCAGAGATGGAGAGCCTAGGTGG - Exonic
1099325859 12:81213684-81213706 GGAGAGGAGGGCAGCAGAGGTGG - Intronic
1099778506 12:87165070-87165092 GGAGAAGTGGTGAGCAAAGGAGG + Intergenic
1100130658 12:91489315-91489337 GGAGAAGTGTGGAGCAAAGGGGG + Intergenic
1101540125 12:105657605-105657627 GGAGAAGTGCTGAGCCAAGGGGG - Intergenic
1101640231 12:106581950-106581972 GGTGGGGTGGGGAGGGCAGGGGG + Intronic
1101824619 12:108210394-108210416 GGAGTGATGGGGAGCCATGGAGG - Intronic
1102231249 12:111264010-111264032 GAAGATGGGGGGAGCCCTGGGGG - Intronic
1102519775 12:113471144-113471166 GGAAAGGTCCCGAGCCCAGGCGG - Intronic
1102543308 12:113637920-113637942 GGGGAGGAGGGGAGGGCAGGAGG - Intergenic
1102975985 12:117207607-117207629 GGAGAGGAGGGGAGGGGAGGAGG - Intergenic
1103488294 12:121297052-121297074 GGAGGGGCGCGGAGCGCAGGAGG + Intronic
1103580167 12:121908906-121908928 GGGGAGGAGGTGAGGCCAGGAGG + Intronic
1103634599 12:122293294-122293316 GGAGGGCTTGGGTGCCCAGGTGG - Intronic
1103735370 12:123057725-123057747 GTCGCGGTGGGGAGCCCAGGAGG - Intronic
1103899868 12:124297840-124297862 GGGGAGGTGGGGCGCCCTGTGGG - Intronic
1104018348 12:124975344-124975366 CCAGATGTGGGAAGCCCAGGAGG - Intronic
1104249299 12:127075926-127075948 GGAGAGGAGGGGAGGGGAGGAGG - Intergenic
1104606376 12:130192609-130192631 GGTGAGCTGGGGACCCCTGGAGG - Intergenic
1104722215 12:131050897-131050919 TGATAGGAGGGGAGCTCAGGTGG + Intronic
1104729811 12:131098493-131098515 GGAGACCAGGGAAGCCCAGGAGG + Intronic
1105015881 12:132786651-132786673 GGGGAGGTGCGGGGGCCAGGTGG - Intronic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1105313127 13:19230855-19230877 GCAGAGGTGGTGAGCCGAGATGG + Intergenic
1106057708 13:26254256-26254278 GGAGCGGCGGGGCGGCCAGGCGG - Exonic
1106081940 13:26507589-26507611 GGGGTGGAGGGGAGCCCAGCAGG + Intergenic
1106512246 13:30421914-30421936 GGAGAGGTGGGGCGGGGAGGAGG + Intergenic
1106512256 13:30421936-30421958 GGAGAGGTGGGGCGGGGAGGAGG + Intergenic
1106761555 13:32873400-32873422 GGAGAGGCTGGGTCCCCAGGAGG + Intergenic
1107339903 13:39395011-39395033 GGAGCAGTGGGGAGTCCATGGGG - Intronic
1108579552 13:51817118-51817140 GGCGTGGTGGGGAGCCAGGGTGG + Intergenic
1108632017 13:52293648-52293670 GTAGAGGTGGTGGGTCCAGGTGG - Intergenic
1108654681 13:52518946-52518968 GTAGAGGTGGTGGGTCCAGGTGG + Intergenic
1109520324 13:63501931-63501953 GCAGACGTGGAGAGCCTAGGAGG + Intergenic
1110772584 13:79366719-79366741 GGAGGTGGGGGGAGTCCAGGAGG + Exonic
1111289161 13:86140795-86140817 GGAGGGCTGGGGATGCCAGGTGG - Intergenic
1111396131 13:87672069-87672091 GGCGAGGAGGAGAGCCGAGGGGG + Intergenic
1111602613 13:90494122-90494144 GGGGAAGGGGGAAGCCCAGGTGG + Intergenic
1112891031 13:104231804-104231826 GGAGGGGAGGGGAGCGGAGGGGG - Intergenic
1113358977 13:109610718-109610740 GCAGAGGTGGGGAGTGCAGTGGG + Intergenic
1113561317 13:111283648-111283670 GGAAAGGCGCTGAGCCCAGGTGG + Intronic
1113857282 13:113454362-113454384 GCAGAGGCCGGGAGCCCAGCAGG + Intergenic
1114134672 14:19834402-19834424 GGAGAGGTCAGCAGACCAGGGGG - Intergenic
1114266249 14:21074355-21074377 GGAGGGCTGGGAAGCCCTGGAGG - Exonic
1114267545 14:21081737-21081759 GGAGAGGAGGCGAGCCCACGGGG + Exonic
1114359805 14:21959081-21959103 GGAGAGGTCGGCAGACAAGGGGG + Intergenic
1115739427 14:36372588-36372610 GGAGGGGTGGGGAGACCAGAAGG - Intergenic
1115985737 14:39102732-39102754 GTGGAGGTGGGTGGCCCAGGAGG + Intronic
1116171553 14:41408521-41408543 GGAGAGGTTGAGACCTCAGGCGG - Intergenic
1116956389 14:50927969-50927991 GTAGGGGTGGGGGGCCAAGGTGG + Intronic
1116974631 14:51101745-51101767 GGAGAGGTGGGGGGCCTGTGTGG - Intergenic
1117315594 14:54567865-54567887 GGCGGGCTGGGGCGCCCAGGGGG + Exonic
1117374854 14:55110931-55110953 TGATAGGTGGTGAGCCCAGCAGG + Intergenic
1117553489 14:56859997-56860019 GGATTTGTGGGGAGCACAGGAGG - Intergenic
1118137818 14:63047155-63047177 GGAGGGGAGGGGAGGCAAGGAGG - Intronic
1119163708 14:72474973-72474995 GGACAGTTGAGGAGCCCAGGAGG + Intronic
1119404633 14:74390041-74390063 GAAGAGGAGGGGAACCCAGGAGG - Intergenic
1119644744 14:76340095-76340117 GGCAGGGTGGGGAGCCCAGGAGG + Intronic
1121015325 14:90545576-90545598 GGTGAGATGTGGAGACCAGGAGG + Intronic
1121417448 14:93788858-93788880 GGAAAGGCGGGGAGCCAACGCGG - Intergenic
1121428952 14:93873447-93873469 AGAGAGGTGCAGAGCCAAGGGGG + Intergenic
1122234016 14:100322105-100322127 GGACAGGTGGCAAGGCCAGGAGG - Intergenic
1122302085 14:100737030-100737052 GGAGGGCTGGGGAGGACAGGAGG - Exonic
1122693291 14:103541508-103541530 GGAGAGGCGGGGAGTGCCGGCGG - Intergenic
1122745032 14:103892433-103892455 GGAGAGGCGTGCAGCCCAGCAGG - Intergenic
1122768722 14:104087565-104087587 AGAGGAGTGGGGAGCCCAGCAGG + Intronic
1122843057 14:104476090-104476112 GGAGGGGTTGGGAGTCCAGGGGG - Intronic
1122924039 14:104891694-104891716 GGGGATGTGGGGGGCCCATGTGG + Intronic
1122941518 14:104983496-104983518 GGAGGTGGGGGCAGCCCAGGTGG - Intergenic
1123049281 14:105532800-105532822 GGAGAAGTGGGCAGCTCAGAGGG + Intergenic
1123066748 14:105622809-105622831 GGAGAGGTGGGGAGACCGTGGGG + Intergenic
1123075438 14:105665383-105665405 GGAGAGGTGGGGACAGCATGGGG + Intergenic
1123505656 15:20940031-20940053 GGCGAGGTGGTGAGCCAGGGAGG + Intergenic
1123562891 15:21513738-21513760 GGCGAGGTGGTGAGCCAGGGAGG + Intergenic
1123577728 15:21689976-21689998 GGAGAGGTCAGCAGACCAGGGGG - Intergenic
1123599137 15:21951021-21951043 GGCGAGGTGGTGAGCCAGGGAGG + Intergenic
1123614352 15:22132457-22132479 GGAGAGGTCAGCAGACCAGGGGG - Intergenic
1123681579 15:22768038-22768060 GGAGAGGATGGGAGAGCAGGAGG - Intergenic
1123906966 15:24930964-24930986 GCTGAGGTGGGGAGCCCTAGTGG + Intronic
1124270297 15:28274495-28274517 TGAGGGGTGGGAAGCCCAGCGGG - Intronic
1124438622 15:29671212-29671234 GGAAGGGTCCGGAGCCCAGGAGG - Intergenic
1124644785 15:31430593-31430615 GGAGAGGTGGTTAGGCCACGAGG - Intronic
1124648449 15:31457048-31457070 GGAGCCGTGGGGAGTCGAGGTGG - Intergenic
1124706620 15:31972017-31972039 GGGGAGGTGGGGAGCTCTGGAGG - Intergenic
1125481704 15:40085562-40085584 TGAGAGGTGGGGAGAGCGGGAGG - Intergenic
1125751248 15:42030586-42030608 GGAGATGGTGGGAGGCCAGGTGG + Intronic
1126010770 15:44300135-44300157 GGAGAGGAGGGGAGGGGAGGAGG + Intronic
1126049102 15:44670765-44670787 GGGGAAGTGGGGAGGACAGGTGG - Intronic
1127046097 15:55026968-55026990 GGAGAGTGGGGGAGCGAAGGAGG + Intergenic
1127221797 15:56887608-56887630 GGAAAGGTGGGGAGCGCCGCCGG + Intronic
1127957991 15:63869809-63869831 TGAGAAGTGGGGAGCTTAGGAGG + Intergenic
1128161376 15:65424862-65424884 GGAGAGGTGGTGAGCACAGGGGG - Intergenic
1128374470 15:67065529-67065551 GAGGAGGCGGGGAGCCCCGGCGG + Intronic
1128390036 15:67176528-67176550 GAAGAGGTGGGGAGGCAAGGGGG - Intronic
1128496084 15:68199495-68199517 GGAGAGGGGAGGGGCCCAGCAGG - Intronic
1128539655 15:68517739-68517761 GGAGAGGTGAGGAGCAAATGGGG + Intergenic
1129102893 15:73282975-73282997 GGAGAGGTGGGGCTCCCATGAGG - Exonic
1129194098 15:73954025-73954047 GGGGAGGTGGGGAGCACACAAGG + Intergenic
1129230367 15:74193883-74193905 GGAGAGGCAGGGAGGCCAGCAGG + Exonic
1129336676 15:74856159-74856181 GGTGAGGTGTGGAACCCAAGCGG - Intronic
1129718753 15:77866387-77866409 AGAGAGGTGGGGTGCCTGGGCGG + Intergenic
1129744301 15:78007513-78007535 AGAGATGTGAGGAGCACAGGCGG + Intronic
1130440209 15:83945524-83945546 AGAGAGGTGGGTAGCCTGGGTGG + Intronic
1130460175 15:84154479-84154501 AGAGAGGTGGGGTGCCTGGGCGG - Intergenic
1131731629 15:95287677-95287699 GGAGAGGGGAGGAGGCCTGGGGG + Intergenic
1202971242 15_KI270727v1_random:240872-240894 GGCGAGGTGGTGAGCCAGGGAGG + Intergenic
1202986597 15_KI270727v1_random:424221-424243 GGAGAGGTCAGCAGACCAGGGGG - Intergenic
1132532718 16:461245-461267 TGACAGGAGGGGAGCTCAGGCGG + Intronic
1132553329 16:562120-562142 GGGGCGGTGGACAGCCCAGGTGG + Intronic
1132643879 16:990003-990025 GGAGCTGTGGGGCTCCCAGGGGG + Intergenic
1132666765 16:1084559-1084581 GGAGAACTGGGGAGTCCAGCAGG - Intergenic
1132666776 16:1084591-1084613 GGAGAACTGGGGAGTCCAGCAGG - Intergenic
1132731378 16:1363877-1363899 GTAGAGCTGGGGAGCCCCAGGGG - Exonic
1132799478 16:1744570-1744592 TGAGAGGAGGTGGGCCCAGGTGG - Intronic
1132805355 16:1772742-1772764 GGGGAGGCGGGGAGACCAGGCGG + Intronic
1132841785 16:1981568-1981590 AGAGAGGTGGGCAGGACAGGTGG - Exonic
1132950997 16:2562429-2562451 GGAGAGACGGGGAGGACAGGTGG - Intronic
1132963352 16:2637741-2637763 GGAGAGACGGGGAGGACAGGTGG + Intergenic
1132994803 16:2817371-2817393 GGAGCGGTGGGGAGGACGGGAGG + Intronic
1133014458 16:2933075-2933097 GGGGTGGAGAGGAGCCCAGGAGG - Intronic
1133019950 16:2963010-2963032 GGAGGGGCGTGGAGCCGAGGTGG - Intergenic
1133348076 16:5083597-5083619 GGTGTGTGGGGGAGCCCAGGTGG + Intronic
1133748825 16:8708451-8708473 GGGGTGGTGGGGGGCGCAGGTGG + Intronic
1133995390 16:10744190-10744212 GGAGAGGGGTGGGGCCCAGAAGG + Intronic
1134023365 16:10937196-10937218 GGAGAGGTGGCCAGGCCTGGGGG + Intronic
1134412411 16:14014082-14014104 GGAGAGGAGGGGAGGGCATGGGG - Intergenic
1134488622 16:14678815-14678837 AGAGAGATGGGGAGCCAAGGAGG - Intronic
1134794592 16:17023441-17023463 TGAGAGGTGGGGAGACCATCAGG - Intergenic
1135174401 16:20215269-20215291 GGGGAGGAGGGGAGAACAGGCGG + Intergenic
1136234273 16:28904645-28904667 GGGGAGGGCTGGAGCCCAGGAGG + Exonic
1136239907 16:28937389-28937411 GCAGAGGTGGGGGGCCACGGGGG - Intronic
1136247129 16:28982476-28982498 GGAAGGGTGCAGAGCCCAGGAGG - Exonic
1136298912 16:29320381-29320403 GAGGAGGGTGGGAGCCCAGGAGG + Intergenic
1136356146 16:29745789-29745811 GCAAAGCTGGGGAGCCCAGGAGG - Intronic
1136399642 16:30010533-30010555 GGAGCAGAGGGGAGCCCCGGAGG - Intronic
1136735218 16:32461244-32461266 GGAGGTGTGGGGGGCCTAGGGGG + Intergenic
1136990630 16:35149299-35149321 GGGGAGGTGGGGAATCCAGAGGG - Intergenic
1137811619 16:51358145-51358167 GGAAATGTGGGCAGCCCAGCAGG - Intergenic
1137899151 16:52246182-52246204 AGGGAGATGGGGAGCCCTGGGGG - Intergenic
1138306587 16:55982180-55982202 GAAGAGGTGGGGAGTGAAGGTGG - Intergenic
1138501480 16:57447600-57447622 GGAGAGGCGGGGAGCGCGGAGGG + Intronic
1138656748 16:58495891-58495913 GGAGTGAATGGGAGCCCAGGAGG + Intronic
1139466118 16:67155060-67155082 GGAGAGGCGGGGTCACCAGGAGG - Intronic
1139528594 16:67530606-67530628 GCTGAGATGGGCAGCCCAGGTGG + Intronic
1139579158 16:67861945-67861967 GGAAGGGTGGGGATCGCAGGAGG + Intronic
1139655631 16:68385571-68385593 GGAGATTTGGGGATCCAAGGTGG - Intronic
1139983273 16:70877678-70877700 TGAGAGGAAGGGAGCTCAGGTGG + Intronic
1139997619 16:70995737-70995759 GGAGGGGTGGGCAGCCCTGCAGG + Intronic
1140087286 16:71808595-71808617 GGAGAGGCCGGGAGCCCCAGGGG - Intronic
1141078620 16:81031612-81031634 GGAGAGGTGTGGAACACAAGGGG - Intronic
1141490680 16:84370497-84370519 AGGGAGGTGGGGAGGCCGGGTGG + Intronic
1141671888 16:85496479-85496501 GGCGAGGCGGGCAGCCCGGGTGG + Intergenic
1141751762 16:85962877-85962899 GGAGAGGTGGGGACCCGCTGAGG - Intergenic
1141777702 16:86135265-86135287 GGAGAGGTGTGGCGTCCAGTGGG - Intergenic
1141792963 16:86249111-86249133 GGAGTTGAGGGGAGCCCCGGAGG + Intergenic
1141887323 16:86901492-86901514 GGAGTGCTGGGGAGCCTTGGAGG + Intergenic
1142060593 16:88026936-88026958 GAGGAGGGTGGGAGCCCAGGAGG + Intronic
1142130523 16:88429778-88429800 GGGGGCGAGGGGAGCCCAGGGGG - Exonic
1142152032 16:88516907-88516929 CCAGAGGTGGGGAACCGAGGGGG - Intronic
1142264039 16:89055425-89055447 GGTGATGGGTGGAGCCCAGGTGG - Intergenic
1142435919 16:90057224-90057246 GGAGACAGGGGGAGCCAAGGGGG + Intronic
1142669711 17:1482598-1482620 GGCGGGGTGGGGAGGGCAGGGGG - Intronic
1142913804 17:3117141-3117163 AGAGAGGTGGGGGCCACAGGTGG - Intergenic
1142977889 17:3656251-3656273 GCAGGGGTGAGGACCCCAGGGGG - Intronic
1142991290 17:3732862-3732884 GTCCAGGTGGGGAGCCCTGGTGG - Intronic
1143033784 17:3982756-3982778 GGTGAGTTGGGGAGGCCAGCAGG + Intergenic
1143166420 17:4899339-4899361 GCGGCGGCGGGGAGCCCAGGAGG + Exonic
1143353308 17:6305888-6305910 GGAGAGGTGGGCTCCCCAGTGGG - Intergenic
1143517163 17:7425648-7425670 GCAGAGGGGGGTGGCCCAGGTGG + Exonic
1143560087 17:7688543-7688565 GAAGAGGAGGGAAGCACAGGTGG + Exonic
1143563616 17:7709033-7709055 GGAGAGATGGGGTCCCCAAGGGG + Intronic
1143724466 17:8835904-8835926 GGAGAGGTGGGGAGACACAGTGG - Intronic
1143785352 17:9251536-9251558 AGAGAGGTGGGTAGCAGAGGAGG + Intronic
1144002991 17:11072941-11072963 GAAGAGGAGGGGCTCCCAGGAGG - Intergenic
1144092676 17:11871978-11872000 GGAGAGGTGCTGCCCCCAGGTGG - Intronic
1144166280 17:12614022-12614044 AGAGGAGTGGGTAGCCCAGGTGG - Intergenic
1144755631 17:17679050-17679072 GGAGAGGGTGGGAGACCAGCTGG - Intergenic
1145259511 17:21346524-21346546 GGGCAGGTAGGGAGCCCAGAGGG - Intergenic
1145317106 17:21741424-21741446 GGGCAGGTAGGGAGCCCAGAGGG + Intergenic
1145911406 17:28545510-28545532 TGAGAAGTGGGGAGCCCCTGTGG - Intronic
1146498353 17:33343156-33343178 GGAGAGGCTGAGAGCCCAGATGG + Intronic
1146520533 17:33522193-33522215 GGGCTGGTGGGGAGCCCACGAGG - Intronic
1146706824 17:35006796-35006818 GGGGCGGTGGGGTGGCCAGGGGG - Exonic
1146901780 17:36593349-36593371 GGGGAGGTAGGGAGATCAGGTGG + Intronic
1146911951 17:36653941-36653963 GCAGCGATAGGGAGCCCAGGAGG - Intergenic
1147131993 17:38415143-38415165 GCAGAGTTGGGGGGCCGAGGCGG + Intergenic
1147459061 17:40557069-40557091 GGAGAGGGCGGGAGCACAGAGGG - Intronic
1147969559 17:44212204-44212226 GCAGAGGTGAGGGGCCCAGAAGG + Intronic
1148021633 17:44557529-44557551 GCAGAGTTGGGGAGGCCGGGCGG - Exonic
1148079564 17:44960173-44960195 GGAGACGTGGGGAGCTCAGTCGG + Exonic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1148335121 17:46835813-46835835 GCAGAGGTGGGGAGTGAAGGGGG - Intronic
1148342923 17:46884141-46884163 GAAGAGGTGGGGGTCCCGGGGGG - Intronic
1148371716 17:47104680-47104702 GGAGAGGTGGGCAGATCATGAGG - Intergenic
1148506468 17:48131239-48131261 GGAGAGGTGGGTGGCAGAGGAGG + Intergenic
1148764364 17:50028639-50028661 GGAGGGGAGCTGAGCCCAGGCGG - Intergenic
1148769794 17:50060177-50060199 GGATAGGAGGGGAACACAGGAGG + Intronic
1148820275 17:50355992-50356014 GCCGAGGTGGGTAGCCCAGCAGG + Exonic
1148975913 17:51528117-51528139 GGAGAGGTGGGGGGCGGGGGTGG - Intergenic
1149466687 17:56885615-56885637 GGAGAGGTGCTGAGCCAAGCAGG + Intergenic
1149515190 17:57275745-57275767 GGAGAGAAGGGGTGGCCAGGAGG + Intronic
1149746777 17:59106597-59106619 GAAGAGATGGGGCGCGCAGGTGG - Exonic
1149867860 17:60160782-60160804 GGGAAGGTGGGAAGCCCTGGGGG + Intronic
1150007744 17:61480065-61480087 GAAGGGGTGGGGAGGACAGGAGG - Intronic
1150086792 17:62277676-62277698 GGGAAGGTGGGAAGCCCTGGGGG - Intronic
1150160502 17:62894024-62894046 GGAGAGCAGGGGACCCAAGGAGG + Intergenic
1150225622 17:63523160-63523182 GCAGAGGAGAGGAGGCCAGGAGG + Intergenic
1150387643 17:64774067-64774089 AGAGAGGAGGGGCCCCCAGGTGG + Intergenic
1150473956 17:65460262-65460284 GGAAAGCTCTGGAGCCCAGGTGG + Intergenic
1150808429 17:68337238-68337260 GGAGGGGAGGGGAGCGAAGGTGG + Intronic
1151183980 17:72350079-72350101 GGAGAGTTGGAGCTCCCAGGAGG - Intergenic
1151305973 17:73262829-73262851 GGAGAGGTGGGCAGCCCCGCAGG + Intergenic
1151419976 17:73990843-73990865 GGGCAGGTGGGGAGGTCAGGAGG - Intergenic
1151578158 17:74963159-74963181 GGACAGGGGCTGAGCCCAGGCGG + Intronic
1151684687 17:75639655-75639677 GGAGAGGTTGGGGGGCCTGGGGG + Exonic
1151998739 17:77631297-77631319 TGAAAAGTGGGGAGCCCAGAGGG - Intergenic
1152148069 17:78581123-78581145 GGAGAGCTGAGGAGCCCAGCGGG - Intergenic
1152162854 17:78679963-78679985 GGACACGTGGGGAACCCAGATGG + Intronic
1152254713 17:79231136-79231158 TGAGAGGTGGGGAGCCAAGGTGG + Intronic
1152336162 17:79701173-79701195 GGGGAGGAGAGGAGCACAGGTGG + Intergenic
1152336197 17:79701263-79701285 GGGGAGGAGAGGAGCACAGGTGG + Intergenic
1152336227 17:79701347-79701369 GGGGAGGAGAGGAGCACAGGTGG + Intergenic
1152336306 17:79701549-79701571 GGGGAGGAGAGGAGCACAGGTGG + Intergenic
1152336339 17:79701639-79701661 GGGGAGGAGAGGAGCACAGGTGG + Intergenic
1152404057 17:80086617-80086639 GAAGGGTTGGGGAGCCCCGGTGG - Intronic
1152469563 17:80483172-80483194 GAAGGGGTGGGGAGCCTGGGAGG + Intergenic
1152544961 17:80995785-80995807 GGAGGTGTGGGGAGCCCATTGGG + Intronic
1152635585 17:81429366-81429388 GGAGGGGAGGGGATCCCGGGGGG - Intronic
1152730425 17:81967195-81967217 GGGGAGGTGCCGAGGCCAGGCGG + Intergenic
1152807938 17:82366036-82366058 GGAGAGGTGGGAGGCCCTGCAGG + Intergenic
1152952940 18:11644-11666 GGGGAGGTGGGGGGCCTAGGAGG - Intergenic
1153476817 18:5506155-5506177 GCAGAGGTAGGGAGACCAGTTGG - Intronic
1153787566 18:8548324-8548346 GGAGTGGTGGGGAGTGGAGGCGG + Intergenic
1154263234 18:12856218-12856240 GGAGAGGAGAGGTGCCAAGGCGG + Intronic
1155508256 18:26551046-26551068 GCAGAGGTGGGGAGACCTGGGGG - Intronic
1155612060 18:27676961-27676983 GGAGAGGTGGGGTTCCAGGGAGG + Intergenic
1156064276 18:33120266-33120288 GGAGAGATGAGGAGCCCAAATGG - Intronic
1156883301 18:42106012-42106034 GGAGAGGTGGGGAGAGAAGATGG - Intergenic
1157212971 18:45759713-45759735 GGCGTGGTTGGGAGTCCAGGGGG - Intergenic
1157572704 18:48723575-48723597 GGAGTGGTGGGCAGCTCAGGGGG + Intronic
1158038105 18:53059087-53059109 GGAGAAGTGTGGAGCCAAAGGGG + Intronic
1158451199 18:57567103-57567125 GGTGAGGTGGGGGGCCTGGGAGG - Intronic
1159017558 18:63114069-63114091 GGTGAGGTGGGGAGCAGCGGGGG + Intergenic
1159927394 18:74281490-74281512 GGAGAGGATGGCAACCCAGGAGG + Intronic
1160015747 18:75139329-75139351 GGAGAGGAGAGGAGCCCCGTAGG + Intergenic
1160218113 18:76951918-76951940 GGAGAGGTGGGATGGCCAGTTGG + Intronic
1160695978 19:484740-484762 GGTGAGGAGGGGAGAGCAGGAGG + Intergenic
1160733644 19:652140-652162 GGAGAGCCGGGGAGGCGAGGTGG + Intronic
1160744272 19:703548-703570 GAGGAGGTGGGGAGACCCGGAGG + Intergenic
1160819028 19:1049508-1049530 GGAGTGGTGGGGGGCTCACGGGG - Intronic
1160819062 19:1049584-1049606 GGAGTGGTGGGGGGCTCACGGGG - Intronic
1161206141 19:3042228-3042250 GGAGAGGAGGGGAGAGGAGGAGG + Intronic
1161266609 19:3367244-3367266 GGAGAAGTTGGAGGCCCAGGAGG + Intronic
1161466509 19:4433539-4433561 GGTGAGGTGGGGTGGGCAGGTGG + Exonic
1161714602 19:5868175-5868197 GGAGAGGTGGGGAGGATAGGAGG + Intronic
1161730641 19:5958666-5958688 GGAGTGGGTGGCAGCCCAGGAGG + Intronic
1162328242 19:10011203-10011225 GGTGAGGTTGGGACCCCAGTTGG - Intergenic
1162548695 19:11346376-11346398 GGAGGGGGCGGGATCCCAGGGGG - Intronic
1162574562 19:11491497-11491519 GGAGAGGAGGCGAGGACAGGAGG - Intronic
1162647077 19:12057629-12057651 GGAGGGATGTGCAGCCCAGGAGG + Intergenic
1162876814 19:13626662-13626684 GGAGAGGAGGGGAGGGAAGGGGG + Intergenic
1163012135 19:14433165-14433187 GGAAAGGTGGGGAGCCGATGGGG + Intronic
1163066396 19:14799399-14799421 TGAGAGGTGGGAACCACAGGTGG + Exonic
1163070317 19:14835052-14835074 GGTGAGTTGGAGAGCCCAGTGGG - Exonic
1163081004 19:14942201-14942223 TGAGAGGTGGGAACCACAGGTGG - Exonic
1163156119 19:15440666-15440688 GGGGTGGTGGGGAGCCCGGCCGG + Intronic
1163251505 19:16128727-16128749 GGAGAAGGGAGCAGCCCAGGTGG - Intronic
1163366802 19:16880025-16880047 GCGGGGGTGGGGAGCCCAGGAGG - Exonic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
1163476213 19:17527413-17527435 GGACAGGGTGGGAGTCCAGGTGG + Intronic
1163518780 19:17779903-17779925 GGACAGCCGGGGAGCCCAGAGGG + Intronic
1163708833 19:18833128-18833150 TGAAAGGTGGGGTGCCCAGATGG - Intronic
1163762511 19:19145434-19145456 GGAGGGTTGGGGAGGCAAGGCGG - Intergenic
1165370361 19:35401831-35401853 AGAGAGGTGGGGAGCCTCTGTGG + Intergenic
1165412357 19:35670034-35670056 GGGGAGGTCAGGAGCCGAGGAGG + Intronic
1165432391 19:35780357-35780379 GGGGGTGTGGGGAGCCCAGCTGG - Intronic
1165434212 19:35787724-35787746 GGAAGGATGGGGGGCCCAGGGGG - Exonic
1165742539 19:38212251-38212273 GGAGAGGTGGGCATCCCATGGGG - Intronic
1165746611 19:38233511-38233533 GGTGGGATGGGGAGCACAGGCGG + Intergenic
1165789510 19:38483159-38483181 GGAGATGTGGGGAGGCCAGGCGG + Intronic
1165803745 19:38567964-38567986 GGAGAGGTGGGCACCAGAGGTGG - Intronic
1165839194 19:38777281-38777303 GCTGAGGTGGTGAGCCCAGGAGG - Intergenic
1165845177 19:38813275-38813297 GGACAGGTGGGCAGCGGAGGAGG + Exonic
1165940674 19:39413419-39413441 GGGGAGGCGAGGGGCCCAGGCGG + Intronic
1166039872 19:40195364-40195386 GGAGAGGTGGGGACCTAAGAAGG + Intronic
1166104169 19:40589450-40589472 GGTGGGATGGGGGGCCCAGGCGG + Intronic
1166144618 19:40825379-40825401 GGAGAGCTGGGGAACGCAGAAGG + Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166693019 19:44835445-44835467 AGAGAGGTTTGGGGCCCAGGTGG + Intergenic
1166746865 19:45145803-45145825 GGAGGGGTGGGGGACGCAGGGGG - Exonic
1166755284 19:45187091-45187113 GGAGATGGGTGGAGGCCAGGAGG + Intronic
1166887523 19:45971354-45971376 GGAGAGGTCAGGGACCCAGGAGG - Intronic
1167007808 19:46787089-46787111 TGAGGGGAGGGGACCCCAGGAGG - Intronic
1167072259 19:47228046-47228068 GGGGAGGTGGCGGGCCCAGCCGG - Intronic
1167270286 19:48502260-48502282 GGAGAGGAGGCGGGACCAGGAGG - Intronic
1167300787 19:48676314-48676336 GGAGAGATGGGGAGCCGGGAGGG + Intergenic
1167603460 19:50467529-50467551 GGAGAGGGGGGAAGCGCAGTGGG - Intronic
1167723375 19:51194257-51194279 GGAAAAGTGAGAAGCCCAGGTGG - Intergenic
1167738639 19:51311599-51311621 GGAGAGGTGGGGGGCCGGGGAGG - Intergenic
1167765489 19:51479579-51479601 TGGGATGGGGGGAGCCCAGGAGG + Intronic
1167873314 19:52391127-52391149 GGAGAGTTGGGGAGAGAAGGAGG + Intergenic
1168296012 19:55377618-55377640 GGAGAGCTGTGGGGGCCAGGCGG + Exonic
1168299557 19:55396479-55396501 GGAGGGGTGGGGAGGGGAGGGGG - Intronic
1168336545 19:55600414-55600436 CGAGAGGCGGGGGGCGCAGGCGG + Intronic
1168379527 19:55908188-55908210 GGAGAGGTGGAGAGGGAAGGAGG - Intronic
1168389411 19:55993563-55993585 GGAGAGGAGGGGAGAGGAGGGGG - Intergenic
1168455041 19:56500254-56500276 GGAGAGGTCTGGGGCTCAGGAGG - Intergenic
925042099 2:740164-740186 GGAGAGCTGGAGAGGCCCGGAGG + Intergenic
925146686 2:1587237-1587259 GGAGACCGGGGGAGACCAGGTGG + Intergenic
925146691 2:1587250-1587272 GACCAGGTGGGGAGACCAGGTGG + Intergenic
925146696 2:1587263-1587285 GACCAGGTGGGGAGACCAGGTGG + Intergenic
925390407 2:3490361-3490383 GCAGAGGCCGGGAGCCCTGGGGG - Intergenic
925405401 2:3602741-3602763 GGAGAGGTGGGCTGGCCTGGTGG - Intronic
925996511 2:9298067-9298089 GAAGAAGTGGGCAGCCCAAGAGG + Intronic
926296104 2:11569881-11569903 GGCGGGGTGGGGTGCCCAGCTGG + Intronic
927190187 2:20512095-20512117 GGAGAGGAGAGGAGCACATGGGG + Intergenic
927190373 2:20513084-20513106 GGAGTGGTGGGGAGGGAAGGAGG - Intergenic
927385930 2:22533697-22533719 GGTTAGGTGGAGAGTCCAGGTGG - Intergenic
927512094 2:23650156-23650178 GGGGAGCTGGGGAGACCAGGAGG + Intronic
927640147 2:24840911-24840933 GGAGAGATGGGGAGCCCCTGTGG + Intronic
927732137 2:25483035-25483057 GGGGAGGTGGGGACCCATGGAGG + Intronic
927853563 2:26514362-26514384 GGAGAGGTGGGGAAGCCACCAGG + Intronic
927894979 2:26775784-26775806 GGTGAGGTGGGTAGCTCTGGAGG + Intronic
928270239 2:29849100-29849122 AGAGAGGTGGGAAGAGCAGGCGG - Intronic
929530459 2:42747940-42747962 GGGGAGATGGGGAGGGCAGGTGG - Intronic
929779738 2:44949873-44949895 GGAGCGGTGGGAAGCCGTGGGGG - Intergenic
930094872 2:47559326-47559348 GTAGGAGTGGGGAGCCCAGCAGG + Intronic
930696526 2:54417122-54417144 AGAGAAGTGGGGATCCAAGGAGG + Intergenic
931673699 2:64672486-64672508 GTTGAGGTGGGAAGCCCAGGAGG + Intronic
932421772 2:71605522-71605544 GGGGAGGTGGGGAGGGGAGGGGG + Intronic
932432104 2:71682314-71682336 GAAGAGGAGGGCAGCACAGGTGG + Intronic
932596136 2:73094672-73094694 GCCCAGGTGGAGAGCCCAGGTGG - Intronic
932758916 2:74426800-74426822 GGAGGAGTGGGGAGCAGAGGTGG + Intronic
932778309 2:74542713-74542735 GGAGAATTGCTGAGCCCAGGAGG - Intronic
933167899 2:79095489-79095511 GCAGAGGTGGGAAGGACAGGAGG + Intergenic
933227880 2:79771997-79772019 GGAGAGGAGGGGAGGGGAGGAGG - Intronic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
934310553 2:91858479-91858501 GGAGGTGTGGGGGGCCTAGGGGG - Intergenic
934763086 2:96866941-96866963 GGACAGGTGGGGATGGCAGGAGG + Intronic
934902290 2:98170044-98170066 TGAGAAGTGGGGAGTCGAGGTGG + Intronic
934950718 2:98573551-98573573 AGAGGGATGGTGAGCCCAGGAGG + Intronic
935196340 2:100819224-100819246 GGAGAGGAGGGCAGCGGAGGAGG + Intergenic
937016722 2:118612401-118612423 GGAGAGGTGGCTAGCCAAGCTGG + Intergenic
937089789 2:119198512-119198534 GGAGAGCTGAGGAGGTCAGGAGG - Intergenic
937235977 2:120432256-120432278 GCAGAGGAGGTGAGCCCTGGGGG - Intergenic
937378796 2:121356906-121356928 AGAGGGGCTGGGAGCCCAGGAGG + Intronic
937451088 2:122002651-122002673 CAAGAACTGGGGAGCCCAGGAGG - Intergenic
937953272 2:127404681-127404703 GGAGAGGTGCGGGACCCAGCTGG + Intergenic
937996554 2:127698726-127698748 TGTGAGGTGGGGAGCACTGGGGG + Intergenic
938084324 2:128388796-128388818 TGAGTGCTGGGGAGCCTAGGAGG + Intergenic
938957688 2:136314574-136314596 GGAGAGGAGGGGAGGGGAGGGGG - Intergenic
939172825 2:138715597-138715619 GGACAGGTGGGTTTCCCAGGAGG + Intronic
942162693 2:173208306-173208328 GGAAAATTGGTGAGCCCAGGTGG + Intronic
944328790 2:198440651-198440673 GGTGAGATGGGGAACACAGGAGG + Intronic
944389247 2:199200357-199200379 GGAGGGATGGGGAGGACAGGTGG + Intergenic
944651741 2:201837399-201837421 GGAGAGGTGGGGAGGGAGGGAGG + Intronic
944653397 2:201854822-201854844 GGTGAGGTGGGGAGATGAGGTGG - Intronic
944780887 2:203015334-203015356 GGAAAGGTGGAGAGGCCAGGTGG + Intronic
944973670 2:205023204-205023226 GGAGAGGTGGTGATCCCACTGGG + Intronic
946040175 2:216776260-216776282 AGAGAGGTGGGGGGCCGTGGGGG + Intergenic
946085924 2:217171450-217171472 GGAGTGGGGAGGAGCCCAGGTGG - Intergenic
946171545 2:217898749-217898771 GGAGAGGTGGGGAGGCCCCTGGG + Intronic
946194399 2:218024477-218024499 GCAGAGGTGGGGAGCTGATGGGG + Intergenic
947542858 2:230990705-230990727 GCGGAGGTGGGGGTCCCAGGAGG - Intergenic
947738962 2:232476247-232476269 GGAGAGGGGAGGAGCTCAGCAGG + Intergenic
948121983 2:235537405-235537427 GGCCAGGCGGGGAGGCCAGGTGG + Intronic
948123004 2:235544643-235544665 GCAGAGGTGGGGAGGCCTGCTGG + Intronic
948588631 2:239036071-239036093 GGGGAGGTGGGGTCCCCAGGGGG + Intergenic
948676896 2:239602077-239602099 GGAGAGCCAGGGGGCCCAGGAGG - Intergenic
948834622 2:240620143-240620165 GGCCAGGTGGGGACCCCAGCGGG + Intronic
1169597805 20:7220936-7220958 GGAGAGGAGAGGAGACGAGGAGG - Intergenic
1169800343 20:9507103-9507125 GCGGAGGTCGGGAGCCCAGGCGG - Intergenic
1170041651 20:12045379-12045401 GGAGAGGAGGGGAGGGGAGGGGG - Intergenic
1170128806 20:12996253-12996275 GGAGAGGTGGAGAGCAAATGGGG + Intergenic
1170153964 20:13252914-13252936 GGGGGGCTGGGGACCCCAGGTGG - Intronic
1170654530 20:18273665-18273687 GGAGATGTGGGGACTACAGGAGG + Intergenic
1170794971 20:19539303-19539325 CCAGAGGTGGGGAGGGCAGGAGG - Intronic
1171126876 20:22610293-22610315 GAAGAGGTCTGGAGCCCAGGGGG - Intergenic
1171245390 20:23606397-23606419 AGAGAGGCGGGGAGCCCGGGAGG + Intergenic
1172099539 20:32476883-32476905 AGTGAGGAGGGGAGCCCATGAGG + Intronic
1172995141 20:39064834-39064856 GAGGGGGTGGGGAGGCCAGGTGG - Intergenic
1173198590 20:40937301-40937323 GGAGAGGTGGGAGGGGCAGGAGG + Intergenic
1173681349 20:44884828-44884850 GGAGGGGAGGGGAGCCATGGAGG + Intergenic
1173728317 20:45312046-45312068 AGATAGGTGGGGAGACCGGGAGG + Intronic
1173864614 20:46306348-46306370 GGAAAAGAGGGCAGCCCAGGTGG + Intronic
1174126052 20:48307462-48307484 GGGGCGGGGCGGAGCCCAGGCGG - Intergenic
1174272116 20:49377199-49377221 GGAGGAGTGGGGACCGCAGGAGG + Intronic
1174342199 20:49905049-49905071 GGAGAGGTGGGGAAGCCAGGGGG + Exonic
1174363212 20:50041157-50041179 TGGGAGGCAGGGAGCCCAGGAGG - Intergenic
1175032695 20:55971404-55971426 GGAGATGAGGGGAGCAAAGGGGG + Intergenic
1175089320 20:56488916-56488938 AGAGAGGTGGGGAGGCCGAGAGG - Intronic
1175161713 20:57012734-57012756 GCAGGGGTGGGGAGACCAAGAGG + Intergenic
1175171208 20:57082665-57082687 GCTGGGGTGGGGAGGCCAGGAGG + Intergenic
1175480007 20:59304059-59304081 GGAGAGGGAGGGAGGGCAGGAGG - Intronic
1175779438 20:61672885-61672907 GAAGAGGTGGGGAGAGGAGGAGG + Intronic
1175818190 20:61894583-61894605 GGAGAACAGGGGAGCCCAGAGGG - Intronic
1175832726 20:61975649-61975671 GGAGGGGAGGGGAGGGCAGGGGG + Exonic
1175947484 20:62565609-62565631 GGGGAGATGGGGAGCCCCTGGGG - Intronic
1176135148 20:63519304-63519326 GGAGAGGTGTGCAGCCCCGAGGG - Intergenic
1176138774 20:63536162-63536184 GGAGGGGGTGGGAGGCCAGGTGG - Intronic
1176253633 20:64139362-64139384 GCTGGGGTAGGGAGCCCAGGGGG + Intergenic
1176415360 21:6471551-6471573 GGAGAGGTGGGCAGCACTGAGGG + Intergenic
1176993310 21:15523730-15523752 GGGGAGGTGGTGAGCCAGGGTGG - Intergenic
1177758281 21:25373626-25373648 GGAGGGGTGGGGAGAGGAGGAGG - Intergenic
1178581336 21:33840999-33841021 GCAGAGTTGGGGAGCCATGGTGG + Intronic
1178916605 21:36708605-36708627 TGAGAGCTGGGAAGCCCAAGGGG + Intronic
1179175490 21:39005072-39005094 GGGGAGGCGGGGGGCCCGGGGGG + Intergenic
1179690860 21:43079884-43079906 GGAGAGGTGGGCAGCACTGAGGG + Intergenic
1179711682 21:43267249-43267271 GTACAGCTGGGGATCCCAGGTGG - Intergenic
1179713118 21:43274380-43274402 GGAGGGGAGGGGAGCCCGGGAGG - Intergenic
1179925927 21:44533998-44534020 GCAGAGGTGATGAGCACAGGTGG + Intronic
1179965562 21:44802527-44802549 GGAGAGGCCGGGAGCCCACGCGG - Intergenic
1180036385 21:45252500-45252522 GGAGCGGGGGGCAGCCCAAGCGG - Intergenic
1180038320 21:45262454-45262476 GGTGGGGCTGGGAGCCCAGGTGG - Intergenic
1180089877 21:45528469-45528491 GGAAAGGCTGGGAGCCCAGCCGG + Intronic
1180729827 22:17972991-17973013 CCAGAGGTGGGCAGCCCACGTGG - Intronic
1180871749 22:19150469-19150491 GGCGGGGTGGGGGGCACAGGGGG - Intergenic
1180949138 22:19713443-19713465 GGACGGGTGGGGAGCAGAGGCGG + Intergenic
1181042443 22:20198481-20198503 AGAGAGGGAGGGAGACCAGGCGG - Intergenic
1181048992 22:20229918-20229940 GCAGAGCTGGGGAGCCACGGGGG - Intergenic
1181166494 22:20986130-20986152 GTAGAGGTGGACAGCCCAGAAGG - Intronic
1181286854 22:21758696-21758718 GGTGCAGTGGGGAGACCAGGTGG - Exonic
1181312412 22:21952523-21952545 GGGGGGCTGGGGAGCCAAGGGGG - Intronic
1181419092 22:22785607-22785629 GCAGGGGTGTGGAGGCCAGGGGG - Intronic
1182447626 22:30398627-30398649 AGAGAGGTGGGCAACTCAGGTGG - Intronic
1182763349 22:32740767-32740789 GATGAGGTGGGCTGCCCAGGAGG + Intronic
1183239500 22:36646741-36646763 GGGGTTGTGGGGAGCCCAGGGGG - Intronic
1183269203 22:36850158-36850180 GGAGAGGTAGGGGGTCCAGGAGG + Intergenic
1183369210 22:37423040-37423062 GGCCAGGTGGGGAGTCCAGGGGG + Intronic
1183508063 22:38220338-38220360 GGACAGATGGGGAGCCAGGGAGG + Exonic
1183587777 22:38762848-38762870 GGAGGGGAGGGGAGGCCATGAGG - Intronic
1183655142 22:39180110-39180132 GGGGAGGAGGGAGGCCCAGGAGG + Intergenic
1183665850 22:39245236-39245258 GGACAGGTTAGGAGCCCACGTGG + Intergenic
1183744542 22:39685320-39685342 TGGGAGGTGGGGGGCCCACGGGG + Intronic
1183784834 22:40023317-40023339 GGGGAGCCAGGGAGCCCAGGAGG - Intronic
1184037672 22:41926345-41926367 GGACAGGGAGGGAGGCCAGGGGG + Intronic
1184117826 22:42432287-42432309 GGGGCTGCGGGGAGCCCAGGAGG + Exonic
1184640587 22:45867992-45868014 GGAGTGGTGGGGGGCCCGGGGGG - Intergenic
1185021238 22:48377485-48377507 GGACAGTTGGGGAGGCCATGGGG + Intergenic
1185190315 22:49432370-49432392 GGAGCCGAGGGGAGCACAGGAGG - Intronic
1185330299 22:50249266-50249288 GGGGAGGGGAGGGGCCCAGGGGG + Intronic
949392099 3:3573681-3573703 GGAGAGAAGGGGACCCCAGGTGG - Intergenic
949506346 3:4731730-4731752 GGAGAAGTGGGGGACCAAGGAGG - Intronic
949764648 3:7512826-7512848 GGAAAGGAGGGGAGACAAGGAGG + Intronic
950052944 3:10005879-10005901 GGAGAGGTGGGAACCCCGGGAGG - Intronic
950054376 3:10012857-10012879 GGACAGGTGGGAACCCCAGGAGG - Intergenic
950305563 3:11913304-11913326 GGACAGGTGGGAACCCCAGGAGG - Intergenic
950414025 3:12858142-12858164 GGATAGGTGGAAACCCCAGGAGG - Intronic
950414293 3:12859862-12859884 GGATAGGTGGGGACCTCAGGAGG - Intronic
950414574 3:12861605-12861627 GGACAGGTGGGGACCCCAGGAGG - Intronic
950414902 3:12863595-12863617 GGATAGGTGGGAACGCCAGGAGG - Intronic
950416314 3:12870799-12870821 AGACAGGTGGGAACCCCAGGAGG - Intronic
950528528 3:13539121-13539143 GGATAGTTGGGGAGACGAGGAGG - Intergenic
950876589 3:16280281-16280303 GGAGAGGAGACCAGCCCAGGTGG + Intronic
951563084 3:23987501-23987523 GGAGAGGTGGAGAGTGAAGGGGG - Intergenic
951923899 3:27886430-27886452 AGAGAGGTGGGGAGGAAAGGGGG + Intergenic
953662495 3:44901366-44901388 GAACAGGTGGGGTGCCCAGAAGG - Intronic
953793523 3:45966238-45966260 GGAGAGGGGTAGAGCCCAAGTGG + Intronic
953800310 3:46017882-46017904 GGAGGGAGGGGAAGCCCAGGAGG + Exonic
953925547 3:46980639-46980661 AGATGGGTGGGGAGCTCAGGAGG - Intronic
953979106 3:47404897-47404919 GGGGATGTGGGGAGGCCTGGGGG - Intronic
954004816 3:47582435-47582457 GGAGAGTTGGGGAGGGGAGGAGG - Intergenic
954138668 3:48594092-48594114 CTGGAGATGGGGAGCCCAGGAGG - Intronic
954250331 3:49362418-49362440 GGAGGTTTGGGGAGCCCAGCAGG - Intronic
954413307 3:50380693-50380715 GGAAAGGTGGGGAACTGAGGGGG + Intronic
954628033 3:52033370-52033392 GGAGAGGGGTGCAGGCCAGGTGG - Intergenic
954912722 3:54122489-54122511 GGAGAGGTGGGGAGGGAGGGAGG - Intergenic
956172527 3:66443941-66443963 GGGCAGGTGGGGACCCCAGTAGG + Intronic
956835662 3:73094396-73094418 GGAGAGGAGGGGTGACCAGGAGG - Intergenic
956870629 3:73413754-73413776 GGAGAGGTGGGGCCCGGAGGTGG + Intronic
957029600 3:75224848-75224870 GGAGAGGTGGAGAGCGGAAGAGG - Intergenic
957863731 3:85994726-85994748 GGAGAGGTGGGGAAAACAGCTGG + Intronic
961182320 3:124886842-124886864 GGAGGGGCGGGGAGCGCAGGCGG - Intronic
961285902 3:125802933-125802955 GGCGAGGTGGGCAGATCAGGAGG + Intergenic
961302416 3:125930692-125930714 GGTGGTGGGGGGAGCCCAGGTGG - Intronic
961434132 3:126904909-126904931 GGAAGGGTGGGGTGCCCTGGTGG + Intronic
961504535 3:127361326-127361348 GGGGAGCAGGGGAGCCAAGGAGG + Intergenic
961713674 3:128845158-128845180 GGACAGATGGGAACCCCAGGAGG + Intergenic
961718176 3:128873205-128873227 GGTGAGGTGGGAGGCCCAGAAGG - Intergenic
961778311 3:129305895-129305917 GGAGGGGTGGGGAGCCAGGTGGG + Exonic
961779944 3:129315506-129315528 GGAGCGGCGCGGAGCCCCGGCGG - Exonic
962942014 3:140133614-140133636 GCAGAGGTGGGGGGGCCAGGAGG + Intronic
963168333 3:142226941-142226963 GGAGAGGTGGGTGGCGCAGGTGG - Intergenic
966351222 3:179034427-179034449 GGAGAGGTGGGGAGGGAAGAAGG - Intronic
966732040 3:183159410-183159432 GGTGAGGAGGGGAGACCAGCAGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967276905 3:187784770-187784792 AGGGAGGTGGGGAGCACTGGAGG + Intergenic
968077359 3:195823879-195823901 GAAGAGGTGGGGAGGGCAGGAGG + Intergenic
968404838 4:331190-331212 GCAGAGGTGGGCAGATCAGGAGG - Intergenic
968520080 4:1031241-1031263 AGAGAGCTGGGGTGCCCTGGGGG - Intergenic
968524551 4:1049384-1049406 GGAGAGGTTGGGAGGTCTGGAGG - Intergenic
968581482 4:1397322-1397344 GAAGAGATGGGGGACCCAGGTGG + Intergenic
968581986 4:1399448-1399470 GCATGGGTGGGGAGCACAGGGGG + Intergenic
968729884 4:2264676-2264698 GGAGAGGTCTGGAGCCCCTGGGG + Intergenic
968736786 4:2301481-2301503 GGAAAGGGAAGGAGCCCAGGTGG - Intronic
968737574 4:2305198-2305220 GGAGCGGAGGGCAGCCCAGGCGG - Exonic
968891967 4:3374282-3374304 GGAGAGGAGGGGAACCCGGAGGG - Intronic
969111362 4:4846269-4846291 GGAGAGGGGGCAATCCCAGGGGG + Intergenic
969123827 4:4931229-4931251 AGAGATGTGGGGAACCCTGGAGG + Intergenic
969690679 4:8702480-8702502 GGACAGGTGGGGACCCCAGGAGG + Intergenic
969870632 4:10102391-10102413 GGAGAGGTGATTAGGCCAGGAGG + Intronic
970099225 4:12502214-12502236 GGAGAAGTGTGGAGCAAAGGGGG + Intergenic
970574171 4:17411597-17411619 GGAGGGGAGGGGAGCGAAGGAGG + Intergenic
971416931 4:26440188-26440210 GGAGAAGAGGTGAGCCCCGGGGG + Intergenic
971451507 4:26805629-26805651 GTGGAGGTGGGGAGCCCAGATGG - Intergenic
972056909 4:34815112-34815134 AGGGAGATGGGGAGCCCTGGGGG - Intergenic
972858373 4:43136288-43136310 GTTGATGTGGGGAGCCCAGAAGG + Intergenic
973552718 4:52051647-52051669 GGAGACTTGGGGGGACCAGGCGG - Exonic
974052323 4:56952523-56952545 AGAGAGGTGGGGAGGCCGTGTGG - Intergenic
974752056 4:66154291-66154313 GGAGAGCTGGGGAAGCCAGGTGG + Intergenic
975608715 4:76182572-76182594 GGAGGTGTGGGTAGCCCAGCTGG - Intronic
975655735 4:76639508-76639530 GGAGAGGAGGGCAGCCCAGAGGG - Intronic
975879348 4:78884675-78884697 GAAGAGTGGGGGAGTCCAGGTGG + Intronic
976374121 4:84324886-84324908 GGAGAGTTGGGGAGCAGAGGCGG + Intergenic
978929823 4:114296474-114296496 GGGGAGGTGGGGAGGCTTGGAGG - Intergenic
979151131 4:117316313-117316335 TGGGGGGTGGGGAACCCAGGAGG - Intergenic
979568285 4:122182518-122182540 GGAGCGGAGGGGAGCTCAGATGG - Intronic
979750985 4:124278281-124278303 GCAGAGGTGGGCAGATCAGGAGG + Intergenic
980063476 4:128156171-128156193 GGAGGGTTGGAGAGCCAAGGGGG - Intronic
981978883 4:150767827-150767849 GCCGAGGTGGGCAGACCAGGAGG + Intronic
981998890 4:151004007-151004029 GGAGATTTGTGGAACCCAGGAGG - Intronic
982207236 4:153005922-153005944 GGAGAGAAGAGGAGCCAAGGAGG - Intergenic
983482049 4:168286632-168286654 AAAGAGGTGGAGAGCCCATGTGG + Intronic
983528310 4:168783475-168783497 GGAGAGGTGATGAGACCAGGAGG + Intronic
983919714 4:173333469-173333491 GGAGAGGGACGGAGCTCAGGGGG - Intronic
985532035 5:439461-439483 GGTGAGGATGGGAGCCCAGGAGG - Intergenic
985692432 5:1320907-1320929 GCAGCTGTGGGGAGCCCATGAGG - Intronic
985733405 5:1564056-1564078 GGGGAGGTGAGGAGGACAGGGGG - Intergenic
985747753 5:1656734-1656756 AGTGAGGTGGGGACCGCAGGTGG - Intergenic
985788912 5:1915096-1915118 GGTGATGCGGGGACCCCAGGGGG - Intergenic
985792766 5:1939328-1939350 AGTGATGTGGGGACCCCAGGGGG - Intergenic
986392567 5:7300034-7300056 GGAGAGGATGGGAGAGCAGGAGG - Intergenic
986477927 5:8154567-8154589 GGACAGGTTGGAAGCTCAGGAGG - Intergenic
986710006 5:10481687-10481709 GGTGACGTGGGGGGCCCAGGTGG + Intergenic
987070205 5:14329333-14329355 GAAGAGGTGGGGCTTCCAGGAGG + Intronic
987114260 5:14713849-14713871 GAGGAGGCGGGGAGCCGAGGCGG - Intronic
987118096 5:14742318-14742340 AGAGAGGAGAGGAGCCCTGGAGG - Intronic
987199447 5:15560466-15560488 TGAGCTGTTGGGAGCCCAGGAGG - Intronic
987547634 5:19333395-19333417 GGAGTGGTGGGGTGCACAGGGGG + Intergenic
988412982 5:30911053-30911075 TGAGAGGTGGGGAACCTTGGGGG - Intergenic
989224219 5:39006772-39006794 GGAGAGGAGGGGAGGGGAGGGGG + Intronic
990433500 5:55762668-55762690 GGCGAGATGGGGAGGCCAGGAGG + Intronic
991169002 5:63599138-63599160 GGAGAGGGAGGGAGGGCAGGAGG - Intergenic
991406564 5:66305907-66305929 ACTGAGGTGGGGACCCCAGGAGG + Intergenic
992100340 5:73401588-73401610 GGACTAGTGGGAAGCCCAGGTGG - Intergenic
992365319 5:76084133-76084155 GGAGAGCAGGGGAGCCCGCGGGG + Intronic
993065573 5:83094269-83094291 GGAGGGGAGGGGAGCCTATGGGG - Intronic
994617469 5:102123426-102123448 GGAGTGGTGGGGAGCAAATGGGG - Intergenic
995344000 5:111090891-111090913 GGAGAGGGGAGGAGCCAAGATGG - Intergenic
995869644 5:116730969-116730991 CCAAAGGTGGGGAGCCCTGGAGG - Intergenic
995994609 5:118283104-118283126 GGAGAGGTGGGGAGGGGATGGGG + Intergenic
996140880 5:119907422-119907444 CGGGAGGTGGGGAGGCCATGAGG - Intergenic
996339219 5:122417721-122417743 GGGGAGGTGGGGAGGGAAGGAGG - Intronic
997261762 5:132470745-132470767 GGAGAAGTGGTGAGCCCAGTGGG - Intronic
997614450 5:135236980-135237002 AGAGTGGTGGGGAGACAAGGAGG - Intronic
997624365 5:135321552-135321574 GGAGAGCTGGGGCTCCCAGAAGG + Intronic
997850961 5:137332178-137332200 GGAAGGGTGGGGATCCCAGGAGG - Intronic
998777927 5:145623800-145623822 GGAGAGTTGGGGAGCGCTGTTGG - Intronic
999077023 5:148806076-148806098 GGAGGGGCTGGGAGCCCAAGGGG + Intergenic
999368379 5:151037805-151037827 GGGGAGCTGAGGAGACCAGGTGG - Intronic
1000369549 5:160521504-160521526 GGAGAGGTGCTGAGCCAAGATGG + Intergenic
1001117489 5:168951986-168952008 GGCGAGGTGGGGATCCAGGGCGG - Intronic
1001318362 5:170660723-170660745 GGAGGGTTGGGGAGCCCCGCTGG - Intronic
1001476369 5:172054010-172054032 GGAGAGGTGGGGAGGCATGGAGG - Intronic
1001572032 5:172736346-172736368 GGAGAGGTGGGGACCCGGGGCGG + Intergenic
1002193672 5:177491315-177491337 GGAGAGGAGGGCAGCCAGGGTGG + Intronic
1002489111 5:179561331-179561353 GGAGAGGAGGGGAGGACATGAGG + Intronic
1002593385 5:180306323-180306345 GGAGAGGATGGCAGCCCAGCTGG + Intronic
1002633626 5:180596553-180596575 GGACCGGTGGGCAGCCCTGGTGG + Intergenic
1003012570 6:2439580-2439602 GGAGAGATGGGGAGGAGAGGAGG - Intergenic
1003016705 6:2473898-2473920 GGGGAGTGGGGGACCCCAGGGGG - Intergenic
1003333375 6:5148032-5148054 GGAGAGTGGGGGAGGGCAGGTGG - Intronic
1003550823 6:7100820-7100842 GGAGAGGAGGGGAACTCAGGAGG - Intergenic
1003942740 6:11044554-11044576 GGCGAGGTCGGTCGCCCAGGAGG - Intergenic
1004326107 6:14675438-14675460 GGTGAGGTGGTGTGGCCAGGAGG - Intergenic
1004727823 6:18327680-18327702 GGGAGAGTGGGGAGCCCAGGGGG + Intergenic
1004928061 6:20434900-20434922 AGAGGGGTGGGGAGCCTAGAGGG + Intronic
1005399403 6:25415984-25416006 GGAGGGGTGGGGAGCCAGTGAGG + Intronic
1005883475 6:30076726-30076748 GGAGAGGTGGGGAGAGGAGCAGG - Intergenic
1005997957 6:30942912-30942934 GGAGGGGTGGGGAGGACAAGGGG + Intronic
1006010753 6:31041114-31041136 GGAAGGGCCGGGAGCCCAGGTGG - Intergenic
1006123499 6:31822112-31822134 GGAAAGGTGGGGAGTGCGGGGGG - Intergenic
1006193339 6:32222681-32222703 GGAGAGCTGGGGAGCCCTAGGGG + Exonic
1006317326 6:33298504-33298526 GAAGAGGGTGGGGGCCCAGGTGG - Exonic
1006415660 6:33902390-33902412 GGAGTGGTGGGAAGCCAAGGCGG + Intergenic
1006511728 6:34525301-34525323 GGACAGATGGGGAGCCCTAGGGG + Intronic
1006670205 6:35725642-35725664 GGGGAGTTGGGGAGCCCAAGTGG + Intronic
1007615940 6:43179842-43179864 GGAGAGGGGGGAAGACAAGGGGG - Exonic
1007695931 6:43734306-43734328 GGAGGGGTGGGGAGAGGAGGAGG - Intergenic
1008654409 6:53596950-53596972 GGAGAGGTGGGCAGATCACGAGG - Intronic
1009689268 6:67007033-67007055 GGAGAGGTGAGGGGCAGAGGAGG - Intergenic
1009925791 6:70119172-70119194 GTAGAGGTTGGGAGAGCAGGTGG - Intronic
1011281600 6:85683564-85683586 GAAGTGGAGTGGAGCCCAGGTGG + Intergenic
1011632288 6:89339450-89339472 GGAGAGGAGGGGAGGAGAGGGGG + Intronic
1011715814 6:90104243-90104265 GGAGAGGTGGGGTGTTCAGAGGG + Intronic
1012316659 6:97789753-97789775 GGATAGGTAGGGAGGCCAGCAGG - Intergenic
1014513462 6:122353966-122353988 GGGGGGGTGGGGAGGGCAGGGGG + Intergenic
1015334558 6:132022401-132022423 GGGGATGTGGGGAGGGCAGGGGG + Intergenic
1016558866 6:145371839-145371861 TCAGAGGTAGGGAGCCGAGGAGG - Intergenic
1016939466 6:149472538-149472560 TGAGAGGTGGGGGGCAGAGGTGG + Intronic
1017184611 6:151588436-151588458 GGGAAGGTAGGGAGCCCAGTTGG + Intronic
1017259654 6:152371628-152371650 GGAGAGGAGGGGAGGGCAAGGGG + Intronic
1017398377 6:154029824-154029846 GGAGAAGTGGAGAGCAAAGGGGG - Intronic
1017474024 6:154770204-154770226 GGAGATGTGGGAGGCCGAGGCGG + Intronic
1017637474 6:156456414-156456436 GGAGAGGAGGGGAGGGGAGGGGG - Intergenic
1018088169 6:160322942-160322964 GCAGAGGTGAGGGGCCAAGGAGG - Intergenic
1018262634 6:161985771-161985793 GGAGAGGTGGGCAGGTGAGGTGG - Intronic
1018632845 6:165835480-165835502 GCAGAGCTGGCGAGCACAGGAGG - Intronic
1018702335 6:166436871-166436893 GGGGAAGGCGGGAGCCCAGGAGG - Intronic
1018710865 6:166497501-166497523 GGAGAGGTGAGCAGCCCGTGCGG + Intronic
1018754549 6:166837697-166837719 TGAAGGGTGGGGAGCCCGGGAGG - Intronic
1018962379 6:168457930-168457952 GGGGAGGGGGGCAGCACAGGGGG + Intronic
1019058995 6:169242532-169242554 GGGAAGGTGGGAAGGCCAGGAGG - Intronic
1019108990 6:169694718-169694740 TGAGGGTTGGGGAGACCAGGGGG - Intronic
1019173366 6:170147196-170147218 GGAGAGAAGGGGAGGCCGGGGGG + Intergenic
1019324914 7:433335-433357 GGAGAGATGGCAACCCCAGGAGG - Intergenic
1019327306 7:444775-444797 GCAGAGGTGGCGCGCCCAGCGGG + Intergenic
1019599303 7:1873455-1873477 GGGCAGGTGGGGAGCCCTGGTGG + Intronic
1019724621 7:2594609-2594631 GGAGAGGTGCTGGGCCCTGGGGG + Intronic
1019779585 7:2931424-2931446 ACAGAGGTGTGGAGACCAGGAGG - Intronic
1019881259 7:3863245-3863267 GGAGAGGTAAGGAACCCAGGAGG - Intronic
1019921919 7:4168589-4168611 GGGGAGGAGGGAAGCTCAGGTGG - Intronic
1022090391 7:27104102-27104124 GGAGAGGAGGCGACCCAAGGAGG + Intergenic
1022184475 7:27953976-27953998 GAAGAGGTTGGAAGCCCAGTGGG - Intronic
1022498336 7:30866928-30866950 GGCTAGGATGGGAGCCCAGGAGG - Intronic
1023037168 7:36142144-36142166 GAAGTTGTAGGGAGCCCAGGAGG - Intergenic
1023238061 7:38112022-38112044 GGGGAGATGAGGAGTCCAGGAGG - Intergenic
1023594513 7:41814939-41814961 AGAAAGGAGGGCAGCCCAGGGGG + Intergenic
1024268137 7:47622138-47622160 GGAGAGCTGGGGCGGCCAAGTGG - Intergenic
1024569078 7:50709473-50709495 GGAGAGGGAGTGAGGCCAGGGGG - Intronic
1024579802 7:50792897-50792919 GGGGAGGTGTGGAGTCCAAGCGG - Intronic
1025143395 7:56484065-56484087 GAGGAGGAGGGCAGCCCAGGAGG + Intergenic
1025610468 7:63072383-63072405 GGAGAGGAGGGGAGGGCTGGGGG - Intergenic
1025710159 7:63900937-63900959 GAGGAGGCGGGCAGCCCAGGAGG + Intergenic
1025844297 7:65182147-65182169 GGAGAGGTGGAGAGCCTTGTAGG + Intergenic
1025894626 7:65688480-65688502 GGAGAGGTGGAGAGCCTTGTAGG + Intergenic
1026857122 7:73762327-73762349 GGAGAGCCGGGGAGCCATGGAGG - Intergenic
1026867640 7:73833295-73833317 GAAGGGTTGGGGACCCCAGGAGG + Intergenic
1026947401 7:74325285-74325307 GGAGAGGTGGTCAGAGCAGGTGG + Intronic
1027138345 7:75639697-75639719 GGACAGATGGGGGGCGCAGGAGG + Intronic
1027159441 7:75791554-75791576 CGAGAAGTGGGAAGCCCAGATGG - Intergenic
1029383332 7:100227379-100227401 GGAGAGGTGGCCAGGCAAGGTGG - Intronic
1029399652 7:100335927-100335949 GCAGCCGTTGGGAGCCCAGGAGG - Intergenic
1029421805 7:100475870-100475892 GCAGAGGAAGGGGGCCCAGGTGG + Intronic
1029514989 7:101018491-101018513 GGGGAGGAGGGAACCCCAGGGGG - Intronic
1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG + Intronic
1029538150 7:101167626-101167648 GGGGAGGGAGGGAGCCAAGGGGG + Intergenic
1029604788 7:101591956-101591978 GGAGAATTGTTGAGCCCAGGAGG + Intergenic
1030380020 7:108800884-108800906 GGAGAGGAGGGGAGGGAAGGGGG - Intergenic
1031484375 7:122310431-122310453 CGAGAAGTGGAGAGCCCAGCCGG - Intronic
1031822789 7:126525466-126525488 GGGGAAGTGAGGAGCCCAGCTGG + Intronic
1031920160 7:127594556-127594578 GGAGAAGTGGAGAGCCCAGGTGG + Intronic
1032179019 7:129659707-129659729 GGAGAGGGGGGCAGGCCATGTGG - Intronic
1032262372 7:130347644-130347666 GGCCAGGCGGGGAGGCCAGGAGG - Intronic
1032431328 7:131864483-131864505 GGAGAGTCTGGGAGCCCAGGAGG - Intergenic
1032468301 7:132160646-132160668 GGAGAGTTCGGGAGCCCAGAAGG - Intronic
1032504556 7:132425527-132425549 GGAGAGGTGGGGATCTGATGAGG - Intronic
1032979945 7:137269863-137269885 GGAGAGGTGGGAGGCTCACGAGG - Intronic
1033235663 7:139635988-139636010 GAAGAGGTGGGAACCACAGGGGG - Intronic
1033313579 7:140280111-140280133 TGAGAAGTAGGGAGCCCTGGAGG - Intergenic
1033358953 7:140624233-140624255 GGAGAGCTGCTGAGGCCAGGAGG - Intronic
1034263317 7:149770368-149770390 AGAGAGGTAGGGAGGGCAGGAGG + Intronic
1034266301 7:149782698-149782720 GCAGGGGTAGGGAGCTCAGGTGG + Intergenic
1034275039 7:149820305-149820327 ATAGAGGAGGGGAGCCCCGGGGG - Intergenic
1034464413 7:151218064-151218086 GGAGAGGTATGGTGCCAAGGTGG - Exonic
1034467033 7:151235855-151235877 GGGGAGGTGTGGAGGGCAGGGGG - Intronic
1034469163 7:151246500-151246522 TTAGAGGTGGGCTGCCCAGGGGG + Intronic
1034830228 7:154302553-154302575 AGGGAGGTGGGGAGCCCCGGTGG + Intronic
1035218015 7:157384696-157384718 GAAGTGCTGGGGTGCCCAGGGGG - Intronic
1035381407 7:158443671-158443693 GAAGAGGTGGCTCGCCCAGGTGG - Intronic
1035404560 7:158588687-158588709 GCGGAGGTTGGGGGCCCAGGTGG - Intergenic
1035438576 7:158878117-158878139 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035438590 7:158878172-158878194 GGCGAGGAGGGGAAGCCAGGAGG + Intronic
1035438641 7:158878353-158878375 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035438709 7:158878576-158878598 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035438761 7:158878757-158878779 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035438816 7:158878938-158878960 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035579957 8:733200-733222 TGAGAGGTGGGGAGATGAGGGGG + Intronic
1035663948 8:1366461-1366483 GAAGTGGGGGGCAGCCCAGGAGG + Intergenic
1035867308 8:3099036-3099058 GGAGAGGTGGGCAGTACAGAGGG - Intronic
1035882559 8:3257960-3257982 GGAGAGGCCGTGAGACCAGGTGG + Intronic
1035907735 8:3531863-3531885 GGAGAGGTGGGGCCCCATGGTGG - Intronic
1036212704 8:6855101-6855123 CTGGAGGTGGGGAGCCCATGTGG - Intergenic
1036648248 8:10625486-10625508 GGTCAAGTGGGGAGCCCATGGGG + Intronic
1036777280 8:11622346-11622368 GTAGAGATGGGGAGCATAGGAGG - Intergenic
1037657007 8:20893189-20893211 GGAGAGGTTTTGAGGCCAGGTGG + Intergenic
1038134044 8:24766686-24766708 GAAGGGGAGGGGAGCCCAGCTGG + Intergenic
1038148014 8:24915504-24915526 GGAGACGGGAGGAGGCCAGGGGG + Intronic
1038422020 8:27439541-27439563 TCAGAGGTGGGGAGGCCAGTAGG + Intronic
1039374163 8:37016482-37016504 GGAGAAGAGAGGGGCCCAGGAGG - Intergenic
1039546266 8:38413547-38413569 GGACAGGTGGTGGGCCCAGCAGG + Exonic
1039893363 8:41699185-41699207 GGAGAGGATGGGAGCCTGGGTGG + Intronic
1040026383 8:42786152-42786174 GGAGAGGAGGGGAGGAAAGGAGG + Intronic
1040086733 8:43350553-43350575 GGAGAGGGGTGGAGCCAAGATGG - Intergenic
1040532597 8:48277581-48277603 GCAGAGGTGCAGAGCCCAGGAGG + Intergenic
1042384298 8:68154882-68154904 GGAGAGGTGGGGAATGTAGGAGG + Intronic
1043472756 8:80578513-80578535 GCAGAGGCGGGGAGCGCCGGCGG - Intergenic
1045627718 8:104075846-104075868 GGAGAGGTGGGGAGTATAGTAGG - Intronic
1045647823 8:104316553-104316575 GCATGGGTGGGGAGCACAGGTGG + Intergenic
1046028699 8:108756764-108756786 GGAGGGGAGGGGAGGGCAGGAGG + Intronic
1046768787 8:118098316-118098338 GGAGAAGGGAGGGGCCCAGGAGG - Intronic
1046848936 8:118951719-118951741 TGGGAGGTTGGGAGACCAGGTGG + Intronic
1047204103 8:122789574-122789596 GGAGAGGCCAGGAGGCCAGGAGG + Intronic
1047956798 8:129982829-129982851 AAAGAGGTGGTGAGCCCAGCTGG - Intronic
1048272054 8:133037316-133037338 GGAAAGATGGGGAGTCCAAGTGG - Intronic
1048809577 8:138273795-138273817 AGAGAGGTGGGAAGTGCAGGAGG - Intronic
1048847730 8:138616137-138616159 GGAGAGGTGGAGAGGCCCAGGGG + Intronic
1049358262 8:142199363-142199385 GGAAGTGTGGGCAGCCCAGGGGG - Intergenic
1049422789 8:142524339-142524361 AGGCAGGTGGGGGGCCCAGGTGG - Intronic
1049473225 8:142785490-142785512 GGGGAGGTGGGGGGCAGAGGTGG - Intronic
1049520791 8:143089152-143089174 GCACAGGTGGGGAGCTCTGGGGG + Intergenic
1049531800 8:143158979-143159001 GGATGGGTGGGGGGCGCAGGGGG - Intronic
1049697698 8:143991618-143991640 GGAGGGGTGGGGTGGCCGGGAGG + Intronic
1049775206 8:144400841-144400863 GGAGAGGAGGGGAGGCGGGGAGG + Intronic
1049853319 8:144846089-144846111 GGAGATGACGAGAGCCCAGGAGG - Intronic
1050601919 9:7261686-7261708 GGAGAGGTGGGGAGGGGAGGAGG - Intergenic
1051478295 9:17532607-17532629 GGAGAGGTGAAGAGACCTGGAGG + Intergenic
1052629508 9:31019221-31019243 GGAGAGGAGGGGAGGGTAGGAGG + Intergenic
1052815466 9:33099764-33099786 AGAGAGGAGGGGAACCCAGTAGG - Intergenic
1052993988 9:34539900-34539922 TGAAAGGTGGGGAGCCCCGGGGG + Intergenic
1053003112 9:34588753-34588775 GGAGAGGAGAGGAGCCGAGAGGG + Intronic
1053179597 9:35957358-35957380 GGTGAGGTGGGCAGAGCAGGTGG + Exonic
1053199785 9:36144588-36144610 GCAGAGGTGGGGAGACATGGAGG - Intronic
1053418775 9:37963652-37963674 GCTGAGGTGGAGAGCCCAGAAGG + Intronic
1053605914 9:39658444-39658466 AGGGAGGTGGGGAGCCCTGGGGG + Intergenic
1053863832 9:42415068-42415090 AGGGAGGTGGGGAGCCCTGGGGG + Intergenic
1054247632 9:62683972-62683994 AGGGAGGTGGGGAGCCCTGGGGG - Intergenic
1054561747 9:66718497-66718519 AGGGAGGTGGGGAGCCCTGGGGG - Intergenic
1055465211 9:76558771-76558793 TGAGAGGTGGGGACCCTAAGAGG + Intergenic
1055733177 9:79300083-79300105 GGTGGGGTGGGGAGACAAGGAGG - Intergenic
1055945952 9:81690641-81690663 GGAGAGGTGGGGAGCGGCTGAGG + Intergenic
1056530755 9:87485471-87485493 GGAGGGTTGCTGAGCCCAGGAGG - Intergenic
1056715477 9:89024915-89024937 GGTGTGGCGGGGAACCCAGGAGG + Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1057226682 9:93296519-93296541 GGAGAGGGGAGGAGGCCAAGGGG - Intronic
1057318622 9:93991077-93991099 GGAGTGGTGGGGTGCCACGGAGG - Intergenic
1057518281 9:95739474-95739496 GCAGAGGTGGGGGGTTCAGGAGG + Intergenic
1057911311 9:99022420-99022442 TCAGAGATGGGGAACCCAGGAGG - Intronic
1057928018 9:99170213-99170235 GCAGAGGAGGGGAGTGCAGGCGG - Intergenic
1058217430 9:102252659-102252681 GAGGAGGTGGGGAGCCAGGGGGG + Intergenic
1058814952 9:108674623-108674645 GGACAGGTGAGGAGGCCAGAGGG - Intergenic
1058947318 9:109869878-109869900 GGTGAGGTGGGGAGGACTGGAGG + Intronic
1059061226 9:111037669-111037691 CGAGAGGTGCGGAGCCCCAGGGG + Intronic
1059453946 9:114388008-114388030 GGAGAGGTGGGGAGCGATGCTGG - Intronic
1059456220 9:114402007-114402029 GGAGGGGTGGGCAGGACAGGTGG - Intergenic
1059485254 9:114622045-114622067 GGAGAGGTGAGGATGCCAGGAGG + Intronic
1059517186 9:114907046-114907068 GGAAAGGTTGTGAGCCCAGCAGG - Intronic
1060228078 9:121808340-121808362 GGGGAGGTGAGTCGCCCAGGTGG - Intergenic
1060396899 9:123322652-123322674 GGTGAGGTGGGGAGACCCAGTGG + Intergenic
1060520105 9:124289512-124289534 TGTGTGTTGGGGAGCCCAGGAGG + Intronic
1060658591 9:125389340-125389362 GGCAAGTTGGGGAGCACAGGGGG - Intergenic
1060674112 9:125496854-125496876 GGAGATGTGAGGGGCTCAGGAGG + Intronic
1060788703 9:126470613-126470635 GTAGAGATGGGGAGCCTAGGAGG + Intronic
1060816571 9:126638343-126638365 GGAGTCCTGGGGAGCCCTGGAGG - Intronic
1061052818 9:128206096-128206118 GGAGAGGTCAGGAGCCCTTGAGG - Intronic
1061258736 9:129467606-129467628 GGTGAGGTGAGGAGGGCAGGGGG - Intergenic
1061373940 9:130213126-130213148 GGTGAGGCGGGGAGCCTGGGAGG + Intronic
1061521383 9:131120328-131120350 GGAAGGCTGGGGAGTCCAGGCGG - Exonic
1061871694 9:133524345-133524367 AGAGAGGTGGGGAGGGGAGGTGG + Intronic
1061999131 9:134207316-134207338 GGACAGGTGGGGAGGACACGTGG - Intergenic
1061999149 9:134207367-134207389 GGACAGGTGAGGAGGACAGGTGG - Intergenic
1061999167 9:134207417-134207439 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1061999192 9:134207492-134207514 GGACAGGTGGGGAGGACACGTGG - Intergenic
1061999210 9:134207543-134207565 GGACAGGTGAGGAGGACAGGTGG - Intergenic
1061999228 9:134207593-134207615 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1061999234 9:134207606-134207628 GGACCGGTGGGGAGGACAGGTGG - Intergenic
1061999254 9:134207668-134207690 GGACAGGTGGGGAGGACACGTGG - Intergenic
1061999272 9:134207719-134207741 GGACAGGTGAGGAGGACAGGTGG - Intergenic
1061999288 9:134207769-134207791 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1061999293 9:134207782-134207804 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1061999299 9:134207795-134207817 GGACCGGTGGGGAGGACAGGTGG - Intergenic
1061999317 9:134207845-134207867 GGACAGGTGGGGAGGACAGCTGG - Intergenic
1061999321 9:134207858-134207880 GGACAGGTGGAGAGGACAGGTGG - Intergenic
1061999324 9:134207871-134207893 GGACAGGTGGGGAGGACAGGTGG - Intergenic
1062361928 9:136192424-136192446 GGAGAGGAGGGGAGGGCAGGGGG + Intergenic
1062446558 9:136597714-136597736 GGAAGGGTGGAGGGCCCAGGTGG + Intergenic
1062451437 9:136617359-136617381 GGAGATGTGGGCCGCCCACGGGG + Intergenic
1062453954 9:136627113-136627135 GGCGAGGTGGGCAGGGCAGGGGG - Intergenic
1062604113 9:137336132-137336154 TCAGAGGTGGGGAGGGCAGGAGG + Intronic
1062638735 9:137505933-137505955 GGAGAGGGTGGGGCCCCAGGCGG + Intronic
1185783422 X:2868525-2868547 GGAGAGGTGGGGAGAATAGGGGG - Intronic
1186247639 X:7631501-7631523 AGGGAGGTGGGGAGCCCCAGGGG - Intergenic
1187009408 X:15264832-15264854 GGAGAGGTGGAAAGTCTAGGAGG + Intronic
1187163908 X:16787141-16787163 GCAGTGGCGGGGAGCGCAGGGGG - Intronic
1187530865 X:20095531-20095553 GGAGAAGTGGGGAGACAGGGTGG - Intronic
1189259874 X:39670688-39670710 GGAGGCTTGGGCAGCCCAGGTGG + Intergenic
1189468104 X:41293208-41293230 GAAGAGCTGGGGAACCCATGTGG - Intergenic
1189470884 X:41313239-41313261 CAGGAGGTGGGGAGCCCGGGAGG - Intergenic
1190415695 X:50178467-50178489 GGTGAGGTGGGGAATCTAGGAGG - Intergenic
1190458394 X:50646694-50646716 GGAGAGGAGGGGAGGCAGGGAGG - Intronic
1190737419 X:53264724-53264746 GGGGAGGTGTGGTGTCCAGGAGG - Intronic
1190761381 X:53440852-53440874 GGAGAGCTAGGAAGCCCAAGAGG - Intergenic
1191007055 X:55720749-55720771 GCTGAGGTGGGGGGCTCAGGTGG + Intronic
1191717441 X:64203587-64203609 GGAGAAGTAGGCAGCCCTGGAGG + Intronic
1191808785 X:65163905-65163927 GCAGAGGGGGGGAGCCAAGATGG - Intergenic
1192147827 X:68693754-68693776 GGGCAGGAGGCGAGCCCAGGAGG - Intronic
1192168708 X:68841519-68841541 AGGGAGGTGAGGTGCCCAGGTGG + Exonic
1192319667 X:70079477-70079499 GGAGAGCTGAGGAGCTGAGGTGG + Intergenic
1192693551 X:73390958-73390980 GAAGAGGTTGGGACCCCAGGAGG - Intergenic
1194765466 X:97842940-97842962 GGAGAGGGAGCGAGTCCAGGCGG + Intergenic
1197162824 X:123343271-123343293 GGAGAAGAGAGGATCCCAGGTGG - Intronic
1197971643 X:132120703-132120725 GGAGATGTGGGGCTCCCAGAGGG + Intronic
1198219810 X:134588922-134588944 GGAGATGCGGGGAACCTAGGTGG + Intronic
1198276198 X:135097900-135097922 GAAGAGCTGTGGAGCCCAGGTGG - Intergenic
1198310311 X:135422841-135422863 GAAGAGCTGTGGAGCCCAGGTGG + Intergenic
1198310971 X:135425494-135425516 GAAGAGGTGGGGAGGGGAGGTGG - Intergenic
1199018688 X:142848986-142849008 GGAGGGGTGGGGAGCAGGGGAGG + Intergenic
1199257988 X:145739027-145739049 GGAGAAGTGCGGAGCAAAGGGGG - Intergenic
1199827921 X:151517479-151517501 GGAGAGGGGGAGAGCCAAGATGG - Intergenic
1200222354 X:154397501-154397523 GGAGAGGTGCGCAGAGCAGGCGG - Intronic
1200244396 X:154515460-154515482 GAGGAGGTGGGCAGTCCAGGTGG - Intronic
1202082841 Y:21102478-21102500 GCAGAGGTGGGGAGATCATGAGG - Intergenic
1202379076 Y:24260694-24260716 AGAGAGGTGGGGTGCCTGGGCGG + Intergenic
1202491706 Y:25409427-25409449 AGAGAGGTGGGGTGCCTGGGCGG - Intergenic