ID: 1029520203

View in Genome Browser
Species Human (GRCh38)
Location 7:101056003-101056025
Sequence GCCTTAATATGCCTGTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029520203 Original CRISPR GCCTTAATATGCCTGTATTA GGG Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
903679228 1:25086038-25086060 GCCTTAATTTGCCTGAATGGGGG + Intergenic
905598743 1:39232057-39232079 GTCTTAACATGCCTCTGTTATGG - Intronic
910337326 1:86149269-86149291 GTTTTAAAATGCCTGTGTTATGG - Intronic
911931350 1:103908165-103908187 CCCTCAATATGACTGTATTTGGG + Intergenic
916544609 1:165791720-165791742 GCTATAATATGCCTGTTGTAAGG - Intronic
1071040804 10:81307486-81307508 CCCTTACTATGCATGTGTTAAGG - Intergenic
1071941399 10:90595361-90595383 GCTATAATATGCCTGTTCTAGGG - Intergenic
1072814911 10:98497977-98497999 GCATTAATTTGCCAGTATTAGGG + Intronic
1079941088 11:26681383-26681405 TCCTTAATAAACCTGCATTATGG - Intronic
1082859470 11:57840604-57840626 GCATTATTATCCCTATATTATGG - Intergenic
1082888550 11:58113731-58113753 GCCTTTCTGTGCCTGTTTTATGG + Intronic
1086667785 11:89505133-89505155 GACCTAATATTCCTGTGTTAGGG - Intergenic
1086835889 11:91621892-91621914 GCTTTAATATGCCTGTCTGTTGG - Intergenic
1087448256 11:98283388-98283410 CCCTTAATATCCCAGTACTAGGG + Intergenic
1090915820 11:131161070-131161092 GCCTTAATTTGCCTTAATGAGGG - Intergenic
1093568766 12:20641222-20641244 GCCTTACTCTGTCTGTATTTTGG - Intronic
1095843684 12:46722500-46722522 GGCTTAATAAGGCTGTTTTATGG + Intergenic
1095847977 12:46767674-46767696 GCCTTAACATGACTTTATTAAGG + Intronic
1097422537 12:59398199-59398221 TCCTCAATATGCCTGTTCTAGGG - Intergenic
1099084641 12:78230404-78230426 GCCTTCATATGTCTGAATAAAGG + Intergenic
1099733825 12:86540393-86540415 GCCTCAATGTGACTGTATCAGGG + Intronic
1101550778 12:105759578-105759600 CCTTTAATATGCCTTTAATATGG - Intergenic
1104527250 12:129535606-129535628 ACATGAATATGCCTGTATTCAGG - Intronic
1106940689 13:34775661-34775683 GCCCTAACATGACTTTATTAAGG - Intergenic
1109924002 13:69110029-69110051 CCCTTATGATGCATGTATTAAGG - Intergenic
1114264159 14:21061732-21061754 GCGTTAACATGTTTGTATTAAGG + Intronic
1116713524 14:48398837-48398859 GCCTTAATCCACATGTATTATGG - Intergenic
1117071133 14:52057345-52057367 GCCTTAGTATGCATCTCTTAAGG - Intronic
1117932880 14:60864112-60864134 GCCTTAATCTGAATGTGTTATGG + Intronic
1118366144 14:65098153-65098175 TCCTAAATGTGCCTGTGTTAGGG - Intronic
1126435606 15:48634379-48634401 GCCTTAATCAGCCTCTTTTAGGG - Intronic
1128413342 15:67421136-67421158 GCTTTATTATGCCCATATTACGG + Intronic
1130282143 15:82527496-82527518 GCCTGTATATGCCTGTTTCAGGG - Intergenic
1133658370 16:7889405-7889427 CCCTTTATATACCTGCATTAGGG - Intergenic
1156978577 18:43257571-43257593 GCATTAATATGCATGAATAAAGG + Intergenic
1168063368 19:53906515-53906537 GCCTCAATATACCTGTATGTGGG + Intronic
926258071 2:11227567-11227589 GCATTAAAATGCCTAAATTATGG + Intronic
930393389 2:50789067-50789089 TCCTTAATATGCCTTTGTTTTGG - Intronic
931040357 2:58290982-58291004 GCCTTAATCTCCCTGTATCTTGG + Intergenic
942483281 2:176412822-176412844 GCTTTCATATGCATGTGTTATGG + Intergenic
943168423 2:184363500-184363522 GCCTTATTGTGCATGCATTACGG - Intergenic
943302426 2:186220710-186220732 GCTTTTATATGCCTGTACTGTGG - Intergenic
947395181 2:229679665-229679687 GCCTTATTCTGCCTGTCTGATGG + Intronic
1168908958 20:1429893-1429915 GCATTAATTTGACTGGATTATGG + Intergenic
1173682184 20:44891402-44891424 GCCCAGATTTGCCTGTATTATGG + Intronic
1179351930 21:40619622-40619644 GCTTTAATATCTATGTATTAAGG + Intronic
1179660823 21:42873814-42873836 CCTTTAATATGTCTGTATTTTGG - Intronic
1184946897 22:47810228-47810250 GTGTTTATATGCCTGTGTTAAGG + Intergenic
1185212598 22:49579352-49579374 CCCTGAATATTACTGTATTAAGG + Intronic
949775415 3:7627034-7627056 GCCTTATTATGGCTGAATTAAGG - Intronic
951947444 3:28156329-28156351 GCCTTAATATGGATATATAAGGG - Intergenic
958672481 3:97222068-97222090 ACCTAAATATGCCTGAAATACGG + Intronic
963897325 3:150701046-150701068 GCTTTATTATGCTTGTATTATGG - Intronic
965540848 3:169870176-169870198 GACTTAATATGCCTTTAAAAGGG + Intergenic
966289688 3:178341587-178341609 CCCTTAATATGCTTGTCTTGTGG - Intergenic
967603453 3:191415863-191415885 CCCTCAATAAGCCTGAATTAAGG + Intergenic
970539880 4:17067121-17067143 GCCAAAATATGCCTGCCTTAGGG + Intergenic
976361890 4:84189360-84189382 GTTTTTATATGCCTGTAGTAAGG + Intergenic
977428115 4:96895264-96895286 GAATTAAAATGCCTATATTAGGG + Intergenic
979417255 4:120458584-120458606 CCCTACATATGCCTATATTAAGG + Intergenic
984550164 4:181149892-181149914 CCCTTAATTTTCCTGTTTTATGG - Intergenic
985960210 5:3296264-3296286 GCCTAAATATGCCTGTATGATGG - Intergenic
986435405 5:7725068-7725090 GCCATAATATGAAAGTATTAAGG - Intronic
986524289 5:8656516-8656538 GCTTAAATATCCCTTTATTAGGG - Intergenic
992859177 5:80894171-80894193 CCCTTACTGTGCATGTATTAAGG - Intergenic
994847614 5:105010114-105010136 TACTTAAGATGCCTGTATTCAGG - Intergenic
1002906673 6:1454767-1454789 GCCTCAAAATGCCAGGATTAGGG - Intergenic
1005491121 6:26348211-26348233 GCAATGATCTGCCTGTATTAAGG + Intergenic
1010930148 6:81791602-81791624 GCCTTGATAACCATGTATTATGG - Intergenic
1017178133 6:151524171-151524193 TCCTTACTATGCATGTGTTAGGG + Intronic
1018400945 6:163418860-163418882 GACTTAACAATCCTGTATTAGGG + Intronic
1023118075 7:36882173-36882195 GCCCTAAGAGTCCTGTATTAGGG + Intronic
1026622128 7:71958993-71959015 GCTTTCACATGCCTGTATTTTGG + Intronic
1028147197 7:87331083-87331105 CCCTTACTGTGCCTGTGTTAGGG + Intergenic
1028560449 7:92169213-92169235 GCCTTAAAATGGCAGTTTTAAGG - Intronic
1029520203 7:101056003-101056025 GCCTTAATATGCCTGTATTAGGG + Intronic
1037369072 8:18153988-18154010 TCCATATTATGGCTGTATTAGGG - Intergenic
1045117920 8:99003874-99003896 GCCTTAAAATGACTGTAGTTCGG - Intergenic
1052001798 9:23291882-23291904 GCCTTTATATGCTTTAATTATGG + Intergenic
1053279910 9:36813509-36813531 GCCCTAGTATGCCTGGATTTGGG + Intergenic
1056059087 9:82864037-82864059 CCTTTAATATGGTTGTATTATGG - Intergenic
1193984908 X:88228667-88228689 CCCTTACTGTGCATGTATTAGGG + Intergenic
1195261917 X:103140748-103140770 TATTTAATATGCCTGTATTGCGG - Intergenic
1200470134 Y:3576470-3576492 GCCTTCTCATGACTGTATTAGGG - Intergenic
1202269995 Y:23062106-23062128 GCCTTAACCAGCCTGTATGATGG + Intergenic
1202296032 Y:23358576-23358598 GCCTTAACCAGCCTGTATGATGG - Intergenic
1202422989 Y:24695851-24695873 GCCTTAACCAGCCTGTATGATGG + Intergenic
1202447800 Y:24974235-24974257 GCCTTAACCAGCCTGTATGATGG - Intergenic