ID: 1029524077

View in Genome Browser
Species Human (GRCh38)
Location 7:101084612-101084634
Sequence TTAGGATGATGTGTGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029524077_1029524084 11 Left 1029524077 7:101084612-101084634 CCTCTCCACACACATCATCCTAA No data
Right 1029524084 7:101084646-101084668 CCCTTGCTGCTCCCAGTACCTGG No data
1029524077_1029524086 17 Left 1029524077 7:101084612-101084634 CCTCTCCACACACATCATCCTAA No data
Right 1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029524077 Original CRISPR TTAGGATGATGTGTGTGGAG AGG (reversed) Intergenic
No off target data available for this crispr