ID: 1029524079

View in Genome Browser
Species Human (GRCh38)
Location 7:101084617-101084639
Sequence CCCATTTAGGATGATGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029524079_1029524086 12 Left 1029524079 7:101084617-101084639 CCACACACATCATCCTAAATGGG No data
Right 1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG No data
1029524079_1029524084 6 Left 1029524079 7:101084617-101084639 CCACACACATCATCCTAAATGGG No data
Right 1029524084 7:101084646-101084668 CCCTTGCTGCTCCCAGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029524079 Original CRISPR CCCATTTAGGATGATGTGTG TGG (reversed) Intergenic
No off target data available for this crispr