ID: 1029524086

View in Genome Browser
Species Human (GRCh38)
Location 7:101084652-101084674
Sequence CTGCTCCCAGTACCTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029524077_1029524086 17 Left 1029524077 7:101084612-101084634 CCTCTCCACACACATCATCCTAA No data
Right 1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG No data
1029524082_1029524086 -1 Left 1029524082 7:101084630-101084652 CCTAAATGGGGATGTACCCTTGC No data
Right 1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG No data
1029524079_1029524086 12 Left 1029524079 7:101084617-101084639 CCACACACATCATCCTAAATGGG No data
Right 1029524086 7:101084652-101084674 CTGCTCCCAGTACCTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029524086 Original CRISPR CTGCTCCCAGTACCTGGAAC AGG Intergenic
No off target data available for this crispr