ID: 1029527597

View in Genome Browser
Species Human (GRCh38)
Location 7:101104501-101104523
Sequence GGGGCTCCTGCACTTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029527581_1029527597 30 Left 1029527581 7:101104448-101104470 CCCACGGGAGAGCCTGTTGCAGG No data
Right 1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG No data
1029527592_1029527597 -7 Left 1029527592 7:101104485-101104507 CCTGGTGCCTCCTGTGGGGGCTC No data
Right 1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG No data
1029527583_1029527597 29 Left 1029527583 7:101104449-101104471 CCACGGGAGAGCCTGTTGCAGGC No data
Right 1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG No data
1029527585_1029527597 18 Left 1029527585 7:101104460-101104482 CCTGTTGCAGGCGCCGGAGAGAG No data
Right 1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG No data
1029527587_1029527597 5 Left 1029527587 7:101104473-101104495 CCGGAGAGAGCTCCTGGTGCCTC No data
Right 1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029527597 Original CRISPR GGGGCTCCTGCACTTGGCCA GGG Intergenic
No off target data available for this crispr