ID: 1029530928

View in Genome Browser
Species Human (GRCh38)
Location 7:101124881-101124903
Sequence AGGCAGATTAAAAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029530922_1029530928 5 Left 1029530922 7:101124853-101124875 CCTGCCAGCTGTGAGAAAACAAA No data
Right 1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG No data
1029530920_1029530928 15 Left 1029530920 7:101124843-101124865 CCTCTCTTTCCCTGCCAGCTGTG No data
Right 1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG No data
1029530923_1029530928 1 Left 1029530923 7:101124857-101124879 CCAGCTGTGAGAAAACAAAGCCT No data
Right 1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG No data
1029530919_1029530928 29 Left 1029530919 7:101124829-101124851 CCGACTGTGGTTCTCCTCTCTTT No data
Right 1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG No data
1029530921_1029530928 6 Left 1029530921 7:101124852-101124874 CCCTGCCAGCTGTGAGAAAACAA No data
Right 1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029530928 Original CRISPR AGGCAGATTAAAAAGCAGGA GGG Intergenic
No off target data available for this crispr