ID: 1029532660

View in Genome Browser
Species Human (GRCh38)
Location 7:101135764-101135786
Sequence GGTGAACGAGAGTGGCACGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029532655_1029532660 18 Left 1029532655 7:101135723-101135745 CCTCTCCACGTCGCGCAGGCGCT 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1029532660 7:101135764-101135786 GGTGAACGAGAGTGGCACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1029532656_1029532660 13 Left 1029532656 7:101135728-101135750 CCACGTCGCGCAGGCGCTGCAGA 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1029532660 7:101135764-101135786 GGTGAACGAGAGTGGCACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 110
1029532653_1029532660 25 Left 1029532653 7:101135716-101135738 CCAAGAGCCTCTCCACGTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1029532660 7:101135764-101135786 GGTGAACGAGAGTGGCACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029532660 Original CRISPR GGTGAACGAGAGTGGCACGG TGG Exonic
900669672 1:3843254-3843276 GGTGACCGAGGATGGCACAGCGG + Intronic
900886357 1:5418229-5418251 GGTGAACGGGATTGGCTGGGAGG + Intergenic
903404712 1:23086687-23086709 AGTGAAGGAGAATGGCAGGGAGG + Exonic
908732585 1:67241553-67241575 GGTAACTGAGAGTGGCACTGAGG - Intronic
914921128 1:151848071-151848093 GGGGAAGGAGAGTGGCAGGCAGG + Intronic
919530217 1:198708353-198708375 GGAGAACAAGAGAGGCAGGGAGG - Intronic
1062827562 10:583957-583979 TGTGAAAGAGAGAGGCGCGGGGG + Intronic
1063253190 10:4296500-4296522 GTTGAAGGAGAGTGGCAGGAGGG - Intergenic
1063497968 10:6527636-6527658 GGGGAAAAAGAATGGCACGGTGG - Intronic
1065503143 10:26401396-26401418 GGTGGATGACAGTGGCAAGGAGG - Intergenic
1065697235 10:28391023-28391045 GGTGAACGAGGGAGGCAGGAAGG + Intergenic
1068876514 10:62002569-62002591 TGTGACCGAAAGTGGGACGGTGG - Intronic
1072390147 10:94975512-94975534 GGAGAATGAGAGTGTCAGGGAGG + Intronic
1074246403 10:111698061-111698083 GGTGAAAGAGAGTGAGAAGGGGG + Intergenic
1076658874 10:132042151-132042173 AGTGAACTAGCGGGGCACGGTGG - Intergenic
1079293872 11:19214252-19214274 GGTGAAAAAGAGTAGCACAGCGG + Intergenic
1083803676 11:65060969-65060991 GGTGAAGGAGGGTGGGACGGAGG - Intergenic
1083935877 11:65869953-65869975 TGTGAACGAGTGTGACATGGGGG - Exonic
1089120730 11:116132830-116132852 GGTGGAAGAGAGCGGCAGGGGGG - Intergenic
1090709916 11:129375300-129375322 GGGGAAGGAGAAAGGCACGGTGG + Intergenic
1091235413 11:134019075-134019097 TGTCAACAAGAGTGTCACGGTGG + Intergenic
1092022962 12:5217261-5217283 GGGGAACCAGAGTGACACGATGG - Intergenic
1092940380 12:13402311-13402333 GGTGGAAGAGAGAGGCAGGGAGG - Intergenic
1101136538 12:101749759-101749781 GGAGCAGTAGAGTGGCACGGTGG + Intronic
1101356198 12:103979620-103979642 GGGGAAGGAGAGTGGCATGGGGG + Intronic
1105305965 13:19169497-19169519 GGAGAAAGGGAGTGGCAGGGAGG - Intergenic
1106313892 13:28577138-28577160 GGTGAATGAGAGGGGCAGAGGGG + Intergenic
1106666014 13:31851691-31851713 GGTGAAGCAGTGTGGCATGGTGG + Intergenic
1117851652 14:59978427-59978449 GGTGAAAGAGAATGGCAGTGAGG - Intronic
1125283257 15:38066100-38066122 GGGGAAGGAGAGAGGCACCGAGG + Intergenic
1125509012 15:40282958-40282980 GGTGCGGGTGAGTGGCACGGCGG - Intronic
1127279768 15:57479046-57479068 GGGGAAGGAGAGTGGCAAGTGGG - Intronic
1129260368 15:74363787-74363809 GGTAACTGAGAGTGGCACTGAGG + Intronic
1130635020 15:85610338-85610360 GCTGAAGGAGAGAGGCAGGGTGG - Intronic
1130954553 15:88618000-88618022 GATGAACGAGAGTGACAGGGTGG - Intergenic
1132458492 16:37432-37454 GGTGGACGAAAGTGGCAGTGGGG + Intergenic
1132722188 16:1321850-1321872 GGTGGCCGAGGGTGGCACAGAGG + Intronic
1136524587 16:30820892-30820914 GGAGGACGGGAGAGGCACGGTGG + Intergenic
1137617329 16:49855713-49855735 GGTGAGCGAGCGAGGCCCGGCGG - Intronic
1138333448 16:56233795-56233817 GGGGAACAAGAGTGTCAAGGTGG - Intronic
1143637714 17:8175988-8176010 GGTGAACGTGAGAGGCAGGCAGG + Exonic
1143818974 17:9544038-9544060 GGTGAACCAGAGTGGGATTGCGG - Intronic
1144102413 17:11953385-11953407 GGTGAATGAGAGTGATAAGGAGG - Intronic
1148581410 17:48746697-48746719 GGGGAAAGAGAGTGGAATGGGGG + Intergenic
1148806388 17:50266166-50266188 GAGGACCGAGAGTGGCAGGGAGG - Intergenic
1153752858 18:8251309-8251331 AGAGAACGAGAGAGGCACAGAGG + Intronic
1161720046 19:5897545-5897567 GGGGGTCGAGAGTGGCAAGGAGG - Intronic
1161868746 19:6854149-6854171 GGTGGACGAGACTGGAACTGGGG + Intronic
1163522528 19:17799947-17799969 GGTGATGGGGAGTGGCACAGGGG - Intronic
1163827201 19:19530330-19530352 GGTGAAGGAGGGTGGCAGGCAGG - Intronic
1166617234 19:44261117-44261139 GCTGAAGGAGAGTGGCACAAAGG - Intronic
925227619 2:2199461-2199483 GGGGAAGGAGAGTGTGACGGGGG - Intronic
925240579 2:2322530-2322552 TGTGACGGAGAGTGGCACGCGGG + Intronic
927423801 2:22958872-22958894 GGTGAGCGACAGTGCCATGGAGG + Intergenic
930044229 2:47155063-47155085 AGGGAACGAGAGCGGCACGAAGG + Intronic
934511257 2:94946417-94946439 AGGGAAAGAGAGTGGCAAGGAGG - Intergenic
934728908 2:96643882-96643904 GGTGAAAGGGCGGGGCACGGTGG + Intergenic
937107421 2:119330655-119330677 AGTGAAGGAGAGAGGGACGGGGG - Intronic
937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG + Intronic
938294804 2:130171598-130171620 GGAGAAAGGGAGTGGCAAGGAGG - Intronic
941111081 2:161418945-161418967 AGTGAACGAGGACGGCACGGAGG + Exonic
943769824 2:191704579-191704601 GGTGAAACAGTGTGGCACAGAGG + Intergenic
1168901491 20:1368885-1368907 GGTGAAGGAGGGTGGCAGTGGGG - Intronic
1173185743 20:40838924-40838946 GGTGATGGAGAGGGGCATGGAGG - Intergenic
1179789568 21:43748695-43748717 GGTGAAGGAGAGAGGGAGGGAGG - Intronic
1180963067 22:19771141-19771163 GGTGAAGGAGCTTGGCAAGGAGG - Intronic
1184840064 22:47047425-47047447 GCTGAAGGAGAGGGGCACAGAGG + Intronic
1185276355 22:49951656-49951678 GGAGACCGAGAGAGGCAGGGAGG + Intergenic
956648252 3:71478509-71478531 GAAGAATGAGAGTGGCAAGGAGG + Intronic
959346465 3:105201218-105201240 GTAGAAAGAGAGTGGCAGGGTGG + Intergenic
960896886 3:122514815-122514837 TGTGCGCGGGAGTGGCACGGCGG - Exonic
960955559 3:123028079-123028101 GGTGACCGAGAACGGCAAGGCGG - Intronic
963795460 3:149626936-149626958 GGTGCTGGGGAGTGGCACGGTGG - Intronic
969585535 4:8089343-8089365 GGGGAAGGAAAGTGGCCCGGTGG - Intronic
974649410 4:64734792-64734814 GGTAACTGAGAGTGGCACTGAGG + Intergenic
977064850 4:92302560-92302582 GGTGAAGGAGAGTGGTTGGGAGG + Intronic
979362120 4:119776965-119776987 GGAGCAAGAGAGTGGCAGGGAGG + Intergenic
981066187 4:140488848-140488870 AGTGAGAGAGAGTGGCAGGGAGG - Intronic
984184262 4:176523260-176523282 GCTGAACTAGAGTAGCAAGGAGG - Intergenic
984833041 4:183993404-183993426 GTTAAACGAGAGTAACACGGTGG - Intronic
986814713 5:11396025-11396047 GGTGAAAGAGATGGGCTCGGGGG + Intronic
998041019 5:138951221-138951243 GGTGCAGGAGAAGGGCACGGAGG - Exonic
1001868334 5:175125681-175125703 GGTGAAGGAGAGGGGAAGGGAGG - Intergenic
1001981128 5:176037617-176037639 GGTAAACGAGGGTGGTAAGGAGG + Intergenic
1002236332 5:177806449-177806471 GGTAAACGAGGGTGGTAAGGAGG - Intergenic
1002338323 5:178495652-178495674 GGTCAAGGAGAGTGGGAAGGGGG + Intronic
1003306774 6:4936029-4936051 GGTGAACCACAGAGGCACAGAGG - Intronic
1003829937 6:9997071-9997093 GGTGAAAGAAAGTGGCAAGTAGG + Intronic
1004765975 6:18727377-18727399 GGTAACTGAGAGTGGCACTGAGG + Intergenic
1019618584 7:1978456-1978478 GGGGAAGGAGAGTGGCAGAGGGG - Intronic
1019927611 7:4203655-4203677 GGAGAAGGAGAGTTGCACCGGGG + Intronic
1023895679 7:44431159-44431181 GGTGACCAACAGTGGCACAGTGG - Intronic
1025263633 7:57438852-57438874 GGTGCACGAAAGTGGAAGGGTGG - Intergenic
1029532660 7:101135764-101135786 GGTGAACGAGAGTGGCACGGTGG + Exonic
1029995167 7:105000890-105000912 GGTGGCCGAAAGTGGCACTGGGG - Intergenic
1030348037 7:108455582-108455604 GCGGAACGAGAGAGACACGGAGG - Intronic
1034125084 7:148664029-148664051 GATGAATCGGAGTGGCACGGAGG + Intergenic
1035660447 8:1343732-1343754 TGTGCACGACAGTGGAACGGAGG + Intergenic
1038319376 8:26513741-26513763 GGTGGAGGAGAGGGGCACTGGGG + Intronic
1047349286 8:124058247-124058269 GGTGAACCAGTGTGGCACACAGG - Intronic
1048145848 8:131842394-131842416 TGTGGAAGAGAGTGGCACAGAGG - Intergenic
1049356785 8:142193013-142193035 GATGAAGGAGAGTGGGAGGGAGG + Intergenic
1050087521 9:1981354-1981376 GGTTAAAGAAAGTGGCAGGGCGG - Intergenic
1057379660 9:94556085-94556107 AGGGAAGGAGAGTGGCAAGGAGG + Intergenic
1057948785 9:99353143-99353165 GGTGGAAGAGGCTGGCACGGGGG + Intergenic
1061475730 9:130864726-130864748 GGTGAACGAAGGAGGGACGGGGG + Intronic
1062241682 9:135544260-135544282 GGTGAACGAGACTGGGACACAGG + Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186847368 X:13544063-13544085 GATGAACGAGAGTGGCATCGTGG + Intergenic
1190155946 X:47992592-47992614 GGGGACAGAGAGGGGCACGGGGG - Intronic
1193958701 X:87896302-87896324 GGTAACTGAGAGTGGCACTGAGG - Intergenic
1197526051 X:127564660-127564682 GGAGAAGGGGAGTGGCACAGTGG + Intergenic
1199215214 X:145254238-145254260 GGTGAACAAGATTGGCAGAGAGG + Intronic
1201770896 Y:17615728-17615750 GGTGCAGCAGAGGGGCACGGTGG - Intergenic
1201830659 Y:18290258-18290280 GGTGCAGCAGAGGGGCACGGTGG + Intergenic