ID: 1029532909

View in Genome Browser
Species Human (GRCh38)
Location 7:101137247-101137269
Sequence GGGGACCCGGCACTGTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029532909_1029532912 -8 Left 1029532909 7:101137247-101137269 CCCACAGACAGTGCCGGGTCCCC 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1029532912 7:101137262-101137284 GGGTCCCCGCTCTGTGACTCAGG 0: 1
1: 0
2: 5
3: 36
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029532909 Original CRISPR GGGGACCCGGCACTGTCTGT GGG (reversed) Intronic
900160168 1:1219601-1219623 CGGGACACGGCACTGCCTCTGGG + Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900951093 1:5858636-5858658 GGGGACCCGTCACGGTCTGTCGG - Intergenic
901025936 1:6278781-6278803 GGGGACCCTGTAGTGTCTGTAGG - Intronic
901626774 1:10629300-10629322 GGGGACCCTGGGCTGTCTGTGGG + Intronic
903302466 1:22389337-22389359 GGGGACAAAGCAGTGTCTGTGGG + Intergenic
903519053 1:23933735-23933757 TGGGATCTGGCACTGTCTCTGGG - Intergenic
917923645 1:179771226-179771248 GGGGAGCCGGCACTCTGTCTTGG - Intronic
922776647 1:228217182-228217204 GGGGACGCGGCACCGGCTGGTGG + Exonic
923046228 1:230357481-230357503 TGGGAGCCGGCACTGTCAGGTGG - Intronic
1062834786 10:628595-628617 GGGGACACGGCACAGACCGTGGG + Intronic
1063009879 10:2011707-2011729 GGGGACATGGCATTGTGTGTTGG - Intergenic
1069556439 10:69401544-69401566 GGAGGCCCGGCAGTGTCTGCTGG - Exonic
1069569085 10:69483697-69483719 GGGGCCCTGGTCCTGTCTGTGGG + Exonic
1071248462 10:83790965-83790987 GGGGAACCGGCTCTGCCTTTTGG + Intergenic
1073270905 10:102263111-102263133 TGGGAGCCGGCACTGTGTGTGGG - Intronic
1076317379 10:129551977-129551999 GGGGCTCAGGCTCTGTCTGTGGG + Intronic
1076761399 10:132607726-132607748 GGGGACCCCGCTCTGTGTGGGGG - Intronic
1076885023 10:133258241-133258263 GGTGAGCCGGCCCTGCCTGTGGG + Intergenic
1078144323 11:8712713-8712735 GTGGACCAGGCGCTGTGTGTGGG + Exonic
1079101236 11:17543641-17543663 GTGGACCCGGCTCTGCCTGAAGG + Intronic
1081852321 11:46282253-46282275 GCAGACCCTGCACTGTCTCTGGG + Intronic
1083712803 11:64559395-64559417 GGGGACCCGGAACAGCCTGTGGG - Intronic
1083774489 11:64887868-64887890 TGGGACCCGCAACTGTGTGTAGG + Intronic
1084044724 11:66561989-66562011 GGGGACAGGCCACTGTCAGTGGG - Intronic
1084901304 11:72311852-72311874 GGGCACCCGGCACTACCTGCTGG - Intronic
1085255651 11:75171217-75171239 GGGGAACCAGCTCTGTGTGTGGG + Intronic
1097249848 12:57626503-57626525 GAGGACTTGGCACTGGCTGTGGG + Exonic
1098403393 12:70098043-70098065 GGGGACCCAGCAAAGGCTGTAGG + Intergenic
1103847083 12:123909065-123909087 GGGGACCCGGCCCTGCCCTTAGG + Intronic
1104643855 12:130483774-130483796 GGGCTCCGGGCACTGTGTGTAGG - Intronic
1104643887 12:130483870-130483892 GGGCTCCGGGCACTGTGTGTAGG - Intronic
1107725572 13:43295933-43295955 GGGGACCCAGTGCTTTCTGTAGG + Intronic
1107871105 13:44747383-44747405 GGGGACAGGACACTGTCTGAAGG - Intergenic
1112434971 13:99385370-99385392 GGGGACCACGCACTGTCACTCGG - Exonic
1113617971 13:111694501-111694523 GGGGTCCCTGCACTGTCTTGGGG + Intergenic
1113623504 13:111779762-111779784 GGGGTCCCTGCACTGTCTTGGGG + Intergenic
1114193558 14:20458527-20458549 AGGGGCCAGGCACAGTCTGTGGG + Exonic
1120131024 14:80807916-80807938 AGGGACCCTGCACTATCTTTGGG - Intronic
1122205200 14:100144849-100144871 AGGGAGCCGGCACTGCCTGCTGG + Exonic
1123948071 15:25248502-25248524 TGGGACCTGGCTCTGTGTGTGGG + Intergenic
1127368454 15:58312933-58312955 GGGGAACAGGCACTGTGTGATGG + Intronic
1129270513 15:74417081-74417103 GGGGACCCTGCACTGGGTCTGGG + Intronic
1131908290 15:97168522-97168544 GGGAACCAGGCACTATCTGCAGG - Intergenic
1132317833 15:100902839-100902861 GGGGACCCAGCACTGCCTGCAGG + Intronic
1132958628 16:2610104-2610126 GGGCAGCCAGCTCTGTCTGTGGG + Intergenic
1137612836 16:49830385-49830407 GAGCACCCAGCACTGTCTGGGGG - Intronic
1138515306 16:57532887-57532909 GGGGCCCGGGCCCTGTCTGCTGG + Intronic
1138751945 16:59433164-59433186 GGAGACCCAGCCCTCTCTGTTGG + Intergenic
1142129567 16:88426572-88426594 TGGGAGCCGGCACCGTCTGGAGG + Intergenic
1151733271 17:75923357-75923379 GGGGACCCTGCACCTTCAGTTGG + Exonic
1151951386 17:77356202-77356224 GGGCACCAGGCAGTGTCTGTAGG - Intronic
1151970844 17:77456694-77456716 GGGGGCCCGTCCCTGGCTGTGGG - Intronic
1151970864 17:77456754-77456776 GGGGACCCGTCCCTGGCTGTGGG - Intronic
1155233149 18:23793776-23793798 TGGGATCTGGCACTGTCTTTAGG - Intronic
1156468649 18:37363767-37363789 GGGGACCAGGCACTGTCCAGGGG - Intronic
1160680274 19:408975-408997 GGGGACCCCGCCCGGTCTGCGGG - Intronic
1161469561 19:4449441-4449463 TGGGACCCGGCCCAGTCTGCCGG + Intronic
1162502264 19:11060549-11060571 GGAGACGGGGCACTGTCTGGTGG - Intronic
1163535183 19:17872709-17872731 GGGGTCCCAGCACTGCCAGTGGG - Intronic
1165767391 19:38359934-38359956 GGGGACCTGGCCCCGTCTGGGGG + Intronic
1167618957 19:50550963-50550985 GGGGACCCCGCAGGGCCTGTGGG + Exonic
1168125992 19:54283181-54283203 TGGGATCCGGGACTGTCTCTGGG + Intergenic
1168263652 19:55209435-55209457 GGGTCCCCGGCAGTGTCTGGAGG - Exonic
926000958 2:9332010-9332032 GGGGCCCTGGCACGGTGTGTGGG + Intronic
929546499 2:42858333-42858355 GGGGACCCAGCACAGTCTAGAGG + Intergenic
931668126 2:64624721-64624743 GGGGACCCGGGCCTCACTGTGGG - Intergenic
935828898 2:106978744-106978766 GGGGACCTGTCATTGTCTATAGG - Intergenic
940896518 2:159086333-159086355 TTGGACCCTGCAGTGTCTGTAGG + Intronic
942451341 2:176109433-176109455 GGGGACACGGCGGGGTCTGTAGG + Exonic
1174793151 20:53498732-53498754 GGGGACCTGGCACTGGGTGCAGG - Intergenic
1178385815 21:32149470-32149492 GGGCACCCAGCAGTGGCTGTAGG - Intergenic
1179904206 21:44413788-44413810 GGGGACCTGGCAGTGACTGGAGG + Intronic
1181276245 22:21688884-21688906 GGTGAGCCGGCACTCTCTGCGGG + Intronic
1181534234 22:23533468-23533490 GGGGCCCCGGCTCTGTGTCTAGG - Intergenic
1185410539 22:50679234-50679256 GGGGTCCTGGCTCTGTCTGTAGG + Intergenic
950098434 3:10343378-10343400 GGGGGACGGGCACTGTTTGTAGG - Intronic
951639398 3:24818677-24818699 GGGGCCCCAGCAGTGTGTGTGGG - Intergenic
953057797 3:39402178-39402200 GGGAACCCAGCACTGACTCTGGG + Intergenic
961965099 3:130894111-130894133 GGGGACCCGTCACGGTCCGCCGG - Intronic
967967321 3:194972264-194972286 GGGGACTGGGGACTGGCTGTTGG - Intergenic
969425526 4:7121845-7121867 GGGGACGGGGCTCTGTCTGTGGG - Intergenic
969536749 4:7760958-7760980 GGGGACCCTGGCCTGCCTGTCGG + Exonic
976389318 4:84493162-84493184 GAGGACCCGGCCCTGCCTGCGGG - Exonic
977084626 4:92577297-92577319 AGGGACCTGTCACTGGCTGTGGG + Intronic
979657201 4:123209245-123209267 GGGGTCCTGACACTGTCTCTAGG + Intronic
985084458 4:186298510-186298532 GGGGGCCCGGCGCTCTCTGGTGG - Intergenic
986099003 5:4587902-4587924 GGGGACACGGCATTTTCTCTAGG - Intergenic
996919381 5:128749799-128749821 GGGGACTCGGCACTAGCTGTTGG + Intronic
1000135295 5:158342554-158342576 GGGGATCTGCCATTGTCTGTTGG + Intergenic
1002809901 6:617646-617668 GGAAACCCGGCACTGCCTGCAGG - Intronic
1003603934 6:7542496-7542518 GGGGCCCCGGTCCTGTCTGGTGG + Intronic
1007387362 6:41528861-41528883 GGGGACTGGGGTCTGTCTGTTGG - Intergenic
1007975687 6:46098962-46098984 GGGGAACCAGCACTGGCTGCGGG + Intergenic
1008520166 6:52355663-52355685 GGGGACAAGGCACTGGATGTTGG - Intergenic
1018802709 6:167236166-167236188 AGGAACCCGGCACCCTCTGTGGG + Intergenic
1018843835 6:167540356-167540378 GGGGACCCTTCGCTGTCTCTGGG - Intergenic
1019550698 7:1601033-1601055 GGGGAGCAGGCTCTGTTTGTGGG + Intergenic
1019573555 7:1725206-1725228 AGGGGCCAGGCACTGTCTTTAGG + Intronic
1020261164 7:6531441-6531463 GGGGACTCGCCACTGTGTGGGGG - Intronic
1029532909 7:101137247-101137269 GGGGACCCGGCACTGTCTGTGGG - Intronic
1029737328 7:102472110-102472132 GGGGACCCTGCCCTGTGTGAAGG - Intronic
1032090021 7:128906911-128906933 GGGGACCCCCCAGTGTCCGTGGG + Intronic
1032471868 7:132184675-132184697 GGGGACCAGGCATTGAATGTTGG - Intronic
1035438672 7:158878461-158878483 TGGCACCCGGCACTCACTGTCGG - Intronic
1035957844 8:4101990-4102012 GGGGACCCGGCAATAGCTGAGGG + Intronic
1042850109 8:73208566-73208588 TGGGACACGGGACTCTCTGTGGG - Intergenic
1045047490 8:98293770-98293792 GGGCACCCGGCACTGGGAGTGGG - Intronic
1050632792 9:7578519-7578541 GAGGACCGGGCAGTCTCTGTTGG + Intergenic
1056555436 9:87683903-87683925 GGGCAGGCGGCACTGACTGTGGG - Intronic
1058039083 9:100284433-100284455 GGGGGCCCGGCTCTGCCTGCTGG - Exonic
1059429495 9:114241362-114241384 GGGGTCCCAGCACTGGCTCTGGG + Intronic
1059665855 9:116446031-116446053 GGGGACCAGGCAGTGCCTGGAGG + Intronic
1061730194 9:132608009-132608031 TGAGACCCAGCACTGTCTGCTGG - Intronic
1061993714 9:134173680-134173702 CGGGACTCGGCCCAGTCTGTCGG - Intergenic
1062262425 9:135669660-135669682 GTGGACCTGGCACTGGCTGGTGG + Intergenic
1186216954 X:7310810-7310832 AGGGTCCCGGCTCTGTATGTGGG - Intronic
1191640268 X:63424122-63424144 GGGGCCCTGGGACTATCTGTGGG + Intergenic
1191844121 X:65533877-65533899 GGAGACACGGTAATGTCTGTGGG + Intronic