ID: 1029536949

View in Genome Browser
Species Human (GRCh38)
Location 7:101162819-101162841
Sequence CGGGCTCAGGACCCGGGAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 338}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029536940_1029536949 -1 Left 1029536940 7:101162797-101162819 CCGCGGGTGAGCTCTGGGAGTTC 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536939_1029536949 0 Left 1029536939 7:101162796-101162818 CCCGCGGGTGAGCTCTGGGAGTT 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536929_1029536949 23 Left 1029536929 7:101162773-101162795 CCTCCTGGGCTGGCCCCCGGTCA 0: 1
1: 1
2: 0
3: 15
4: 187
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536935_1029536949 8 Left 1029536935 7:101162788-101162810 CCCGGTCACCCGCGGGTGAGCTC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536925_1029536949 28 Left 1029536925 7:101162768-101162790 CCCGCCCTCCTGGGCTGGCCCCC 0: 1
1: 0
2: 10
3: 92
4: 722
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536933_1029536949 10 Left 1029536933 7:101162786-101162808 CCCCCGGTCACCCGCGGGTGAGC 0: 1
1: 0
2: 1
3: 0
4: 60
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536936_1029536949 7 Left 1029536936 7:101162789-101162811 CCGGTCACCCGCGGGTGAGCTCT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536928_1029536949 24 Left 1029536928 7:101162772-101162794 CCCTCCTGGGCTGGCCCCCGGTC 0: 1
1: 0
2: 1
3: 19
4: 251
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536930_1029536949 20 Left 1029536930 7:101162776-101162798 CCTGGGCTGGCCCCCGGTCACCC 0: 1
1: 1
2: 0
3: 20
4: 337
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536926_1029536949 27 Left 1029536926 7:101162769-101162791 CCGCCCTCCTGGGCTGGCCCCCG 0: 1
1: 1
2: 5
3: 56
4: 525
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338
1029536934_1029536949 9 Left 1029536934 7:101162787-101162809 CCCCGGTCACCCGCGGGTGAGCT 0: 1
1: 0
2: 0
3: 8
4: 44
Right 1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 25
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029536949 Original CRISPR CGGGCTCAGGACCCGGGAGG GGG Exonic
900226896 1:1537135-1537157 CGAGCCCAGGAACAGGGAGGAGG + Intronic
900245064 1:1632817-1632839 TGGGCCCGGGACCCGGGTGGGGG - Exonic
900256295 1:1699976-1699998 TGGGCCCGGGACCCGGGTGGGGG - Intronic
902543143 1:17168389-17168411 CGGGCTCACAGCCAGGGAGGTGG - Intergenic
903468454 1:23568415-23568437 CGGGGCCAGGCGCCGGGAGGAGG + Intergenic
903628176 1:24745820-24745842 CGGGTTGGGGACCCGGGCGGCGG + Intronic
903883789 1:26529851-26529873 GGACCCCAGGACCCGGGAGGCGG + Intronic
904256369 1:29257506-29257528 CTGGCTCAGGACCTGGCGGGGGG - Intronic
904379595 1:30101938-30101960 GGGGCTCAGGCCCTGTGAGGGGG - Intergenic
904442959 1:30543620-30543642 CGAGCTCAGGAGACAGGAGGTGG + Intergenic
904832172 1:33312257-33312279 AGGGCTCAGCACTGGGGAGGTGG - Intronic
908180029 1:61594335-61594357 TGGCCTCAGGACACTGGAGGAGG + Intergenic
908571916 1:65420072-65420094 AGGGCTCAGGATCTAGGAGGAGG + Intergenic
911188785 1:94927503-94927525 TGGGCCCAGAGCCCGGGAGGAGG - Intergenic
914875988 1:151512952-151512974 CGGACTGAGGACCAGGGAGGTGG + Intronic
915126716 1:153670701-153670723 CGGGCCCAGGAGTGGGGAGGGGG - Intronic
917452102 1:175155846-175155868 GGGGCTCAGAACCTGGTAGGGGG - Intergenic
918100459 1:181368627-181368649 GGGGGGCAGGACCAGGGAGGAGG + Intergenic
918275917 1:182953403-182953425 TGGGCTCAGGACAGGGGTGGGGG + Intronic
919744204 1:200998784-200998806 AGGGCTCAGGAGCTGGCAGGGGG + Intronic
920528470 1:206685237-206685259 CGGGCTCTGGCCCTGGGAGTTGG - Exonic
920674641 1:208030577-208030599 CGACCACAAGACCCGGGAGGAGG + Intronic
922424483 1:225480606-225480628 CTGCCTCAGCTCCCGGGAGGAGG - Intergenic
922548955 1:226479864-226479886 GGGGCTCAGGAAACAGGAGGTGG - Intergenic
924384989 1:243492008-243492030 GGGGCTCAGGACCCAGGACAGGG - Intronic
924741167 1:246794998-246795020 CGGCCTCAGGGCCTGGGGGGTGG - Intergenic
1062817140 10:509031-509053 CCGGTTCAGGACATGGGAGGTGG - Intronic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1063264623 10:4434317-4434339 AGGGCACAGGGCCTGGGAGGAGG - Intergenic
1063929911 10:11018305-11018327 CCGGCACGGGACGCGGGAGGAGG + Intronic
1064055965 10:12097732-12097754 CGGACTCATGACGCAGGAGGAGG + Exonic
1064059985 10:12129501-12129523 AGGACCCGGGACCCGGGAGGCGG - Intergenic
1064059990 10:12129508-12129530 CGGTCCCAGGACCCGGGACCCGG - Intergenic
1064539332 10:16389590-16389612 CGGACTCAGGACTTCGGAGGTGG + Intergenic
1065926333 10:30436447-30436469 GGGAAGCAGGACCCGGGAGGTGG - Intronic
1067058357 10:43065208-43065230 CAAGCCCAGGCCCCGGGAGGGGG + Intergenic
1067832955 10:49620893-49620915 CTGGCTGAGGCCCTGGGAGGAGG + Intronic
1067942642 10:50669354-50669376 ATGGCTTAGAACCCGGGAGGCGG + Intergenic
1069849864 10:71397598-71397620 CGGTCCCAGGACCGGGGATGGGG - Intronic
1070137318 10:73706418-73706440 CGGGCTCAGGACCAGGCTGAAGG - Intergenic
1070863881 10:79694309-79694331 ATGGCTTAGAACCCGGGAGGCGG + Intergenic
1073304977 10:102495845-102495867 ATGGCTTTGGACCCGGGAGGCGG - Intronic
1073328318 10:102655320-102655342 TGGGCTCAGGACCAGGCTGGTGG + Intronic
1074794285 10:116925393-116925415 CAGGCTCAAGACCCAGGAAGTGG - Intronic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1076379673 10:130016415-130016437 TGGGCACAGGACCCAGTAGGTGG - Intergenic
1076637196 10:131889815-131889837 CGGGCCCAGGACACTGGGGGAGG + Intergenic
1077043763 11:535538-535560 CGGGCGCAGGGCACGGGCGGCGG + Exonic
1077184923 11:1231648-1231670 CGGGCAGGGGACCGGGGAGGGGG + Intronic
1077560131 11:3255181-3255203 TGTGCTCTGCACCCGGGAGGAGG - Intergenic
1077566024 11:3300984-3301006 TGTGCTCTGCACCCGGGAGGAGG - Intergenic
1077582073 11:3423105-3423127 GGGGCCCAGGGTCCGGGAGGCGG + Intergenic
1078594505 11:12674720-12674742 CGGGCCCAGGGACCGGGAGCCGG + Exonic
1079056199 11:17208242-17208264 CGGACTCAGGGCCCGAGGGGCGG - Intronic
1079071804 11:17353549-17353571 GGGGCGCCGGGCCCGGGAGGGGG - Intronic
1079308490 11:19345082-19345104 AGGGCTCGGGACCCTGGAAGGGG + Intergenic
1080551275 11:33375974-33375996 CGGGCTCGAGACCCAGGAGGGGG - Intergenic
1082986150 11:59172543-59172565 GGCGCTCGGGGCCCGGGAGGCGG + Exonic
1083297441 11:61722684-61722706 CGGGCTTGGGGCCTGGGAGGCGG + Intronic
1083603081 11:63961075-63961097 GGGGCTCAGGGCCAGGGAGCCGG - Intergenic
1083748071 11:64746038-64746060 CGAGGGCAGGACCCAGGAGGGGG - Intergenic
1084129120 11:67119594-67119616 CGGGCCCCGGCCCCGGGGGGCGG - Intronic
1084238991 11:67805922-67805944 GGGGCCCAGGGTCCGGGAGGCGG + Intergenic
1084239114 11:67806282-67806304 CGGGTTAGGGGCCCGGGAGGCGG + Intergenic
1084833442 11:71786918-71786940 GGGGCCCAGGGTCCGGGAGGCGG - Intergenic
1084836338 11:71804384-71804406 CTGGCTCAACTCCCGGGAGGAGG - Intergenic
1085312862 11:75526238-75526260 TGGCCTCGGGACCCGGAAGGAGG + Intergenic
1085681024 11:78574926-78574948 CGGGGTCAGGAGCCGAGACGGGG + Intergenic
1089635405 11:119808550-119808572 TGGTCTCAGGAGCCGGCAGGCGG + Intergenic
1089872167 11:121685317-121685339 GGAGCTCAGGACCCAGGTGGAGG + Intergenic
1202811245 11_KI270721v1_random:28142-28164 GGAGCCCAGGACCCGGGATGGGG + Intergenic
1091447741 12:553658-553680 CGGCCTCAGGCCCCTGGAAGGGG + Exonic
1092409680 12:8243553-8243575 GGGGCCCAGGGTCCGGGAGGCGG + Intergenic
1093779909 12:23123013-23123035 TGGGCTCATGGCCAGGGAGGTGG + Intergenic
1094199236 12:27780148-27780170 CGGGAGCGGGCCCCGGGAGGAGG + Exonic
1095584473 12:43835719-43835741 CGGACTCAGGAACCTGGTGGGGG - Intergenic
1095668401 12:44830625-44830647 CAGGCTCAGAAACCGGGAGATGG - Intronic
1095702059 12:45200887-45200909 GGTGCTCAGGAACCGGGATGTGG + Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096738865 12:53677185-53677207 GGGGCCCGGGAGCCGGGAGGGGG - Intronic
1097029385 12:56080405-56080427 CGGGCTCGGCACCTGGGAGCCGG + Intronic
1098450102 12:70610004-70610026 CGGGCTGCGGACGCGAGAGGCGG + Intronic
1101605999 12:106248009-106248031 CGGGCCGAGGAGGCGGGAGGAGG + Intronic
1101875429 12:108593901-108593923 AGGGCTCAGGTCCCGGAAGCGGG + Intronic
1101999845 12:109550488-109550510 CTGACTCAGGACCCGAGCGGGGG - Intergenic
1102877403 12:116458863-116458885 CGGACTCAGGGCCCCGGAGGTGG - Intergenic
1103595602 12:122022718-122022740 AGGGCGCCGGGCCCGGGAGGCGG - Intronic
1104425862 12:128677653-128677675 AGGGCTGAGGACCAGGGTGGGGG - Intronic
1104961529 12:132490440-132490462 CGGGCTCGGGCCCTGGGCGGCGG - Exonic
1105578888 13:21675483-21675505 AGGGCACAGGCGCCGGGAGGGGG + Intronic
1107805175 13:44146909-44146931 CGTGATCAGGACCAGAGAGGAGG + Intronic
1108403961 13:50081511-50081533 CCGGCTCCGGTCCCGGGCGGGGG + Intergenic
1108689926 13:52850870-52850892 CGGGCGGAGGACCCGGAAGGTGG + Intergenic
1114824673 14:26062582-26062604 CGGGGTAAGGACCTGGTAGGAGG + Intergenic
1115399334 14:32939457-32939479 CGGGCTCGCGGCCCAGGAGGCGG - Intronic
1116426626 14:44798972-44798994 CCGGCGCAGGAGCGGGGAGGTGG - Intergenic
1116849473 14:49893505-49893527 CAGTCTCAGGGCCCGGGTGGCGG + Exonic
1118220887 14:63853512-63853534 CGGGGCCTGGGCCCGGGAGGGGG - Intronic
1119171432 14:72539034-72539056 CGGGCTCAGGACCCTGGAACGGG + Intronic
1119640406 14:76310362-76310384 CGGGCTCAGGATCCGGAGGGGGG + Intergenic
1119793635 14:77376759-77376781 CGAGCCCAGGGCCCGGGTGGTGG + Intronic
1121013526 14:90535145-90535167 AGGGCCCAGGACCTGGAAGGAGG + Exonic
1121294596 14:92808158-92808180 CAGACCCAGGACCCAGGAGGTGG + Intronic
1121624345 14:95373478-95373500 CAGGCACAGGACACGGGAGATGG + Intergenic
1122048537 14:99039946-99039968 CGGGATCAGGACTCAGGAGCTGG - Intergenic
1122081571 14:99270896-99270918 CCGGCTCCGGGCCGGGGAGGGGG - Intronic
1124157582 15:27240300-27240322 AGCGCTCAGAACCCTGGAGGTGG + Intronic
1127071140 15:55289575-55289597 CGGGCTCGGGCGCCTGGAGGCGG + Intronic
1127084026 15:55408185-55408207 CGGGCTTAGACCCCGGGAGGGGG - Intronic
1127267985 15:57376534-57376556 CGGGAGCTGGACGCGGGAGGAGG + Exonic
1129394555 15:75236792-75236814 AGGGCTCAGGATCCAGGAGTGGG + Intergenic
1130323574 15:82860147-82860169 CTGAGGCAGGACCCGGGAGGCGG + Intronic
1130657063 15:85799131-85799153 CAGGGTCAGGAACAGGGAGGTGG - Intergenic
1132556664 16:575608-575630 CGGGGTCAGCACCTGCGAGGAGG + Intronic
1132585833 16:705471-705493 CGGGCTGCGGGGCCGGGAGGGGG - Intronic
1132607869 16:800985-801007 CTGGCCCAGGACACTGGAGGGGG - Intergenic
1132850090 16:2020965-2020987 CTGGGTCATGCCCCGGGAGGAGG + Intergenic
1133164801 16:3938983-3939005 CTGGCTCAGGAACAGGGATGGGG - Intergenic
1133317174 16:4892090-4892112 CCTGCTGAGGACCCGGGTGGAGG - Exonic
1133350651 16:5098334-5098356 GGGGCCCAGGGTCCGGGAGGCGG + Intergenic
1134446871 16:14337657-14337679 GTGCCTCAGGACCTGGGAGGAGG + Intergenic
1136019968 16:27434045-27434067 CGGGCGCAGGGCTCTGGAGGAGG + Intronic
1136780574 16:32897962-32897984 GGTGCTCAGGACACGGGGGGGGG + Intergenic
1137412940 16:48244662-48244684 TGGGCCCAGGTCCCCGGAGGAGG - Intronic
1137612475 16:49828107-49828129 TGGGGTCAGGACCCTGGAGATGG - Intronic
1138230193 16:55330972-55330994 CATGCGCAGGACCCGCGAGGTGG - Intergenic
1138526396 16:57610196-57610218 CAAGCACAGGACCCTGGAGGTGG - Intergenic
1139383633 16:66549966-66549988 CGGCCTCAGGCCCCGGGCCGCGG - Exonic
1139424054 16:66868053-66868075 CAGGCTCAGGCCCCGGGTGGTGG - Intronic
1139631836 16:68236000-68236022 CGGGGTCAGGGCCCGGGGGAGGG + Exonic
1140223167 16:73058374-73058396 CGGGCGCGAGAGCCGGGAGGGGG + Intronic
1140469279 16:75205536-75205558 CGGGGTGAGGCCCTGGGAGGAGG + Intronic
1140472505 16:75223403-75223425 CGGGGTGAGGCCCTGGGAGGAGG - Intronic
1141647300 16:85374668-85374690 CAGGCCCATGACCCTGGAGGGGG + Intergenic
1142005255 16:87686735-87686757 AGGGCTCAGGTCCCTGCAGGAGG + Intronic
1203083204 16_KI270728v1_random:1161928-1161950 GGTGCTCAGGACACGGGGGGGGG + Intergenic
1142468169 17:147643-147665 CGAGCACAGAACCTGGGAGGGGG - Intronic
1142623565 17:1179459-1179481 CGGGGTCGGGACCCAGGAGCCGG - Intronic
1142978558 17:3658949-3658971 TGGGGTCAGGTCCCGGGAGCTGG + Intronic
1143409811 17:6702128-6702150 TGGGCGCAGGAGCTGGGAGGTGG - Intronic
1143684799 17:8505018-8505040 CAGCCTCAGGCCCCAGGAGGAGG - Intronic
1143810891 17:9471119-9471141 GTGGCTCACGCCCCGGGAGGCGG - Intronic
1146912775 17:36658936-36658958 GGGGCTCAGCACCTGGCAGGAGG - Intergenic
1147648564 17:42049132-42049154 CGGGCAAAGGACCCGGGGGATGG - Intronic
1147996407 17:44362562-44362584 GGAGAGCAGGACCCGGGAGGTGG + Intronic
1148444741 17:47730789-47730811 CAGCCCCAGGGCCCGGGAGGAGG + Intergenic
1149998475 17:61417155-61417177 CGGGCCCAGTGCCCGGGAGGCGG - Intergenic
1150724463 17:67640323-67640345 AGGGCTCAGGGCCCGCGATGCGG - Intronic
1151585230 17:75004615-75004637 CCTGGTCAGGACCCTGGAGGTGG - Exonic
1151938956 17:77281201-77281223 CGGGCGCCGGGCCTGGGAGGGGG - Intronic
1152043860 17:77923418-77923440 TGGGCAGAGGACCTGGGAGGAGG + Intergenic
1152073965 17:78147458-78147480 TGGGTACAGGACCAGGGAGGAGG + Intronic
1152607836 17:81301925-81301947 CGGGCTCAGGAACGCCGAGGTGG + Intergenic
1152649208 17:81484144-81484166 CGCGTTCAGGCCCCGGGCGGTGG + Intergenic
1152823304 17:82448270-82448292 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823320 17:82448351-82448373 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823336 17:82448432-82448454 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823352 17:82448513-82448535 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823368 17:82448594-82448616 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823384 17:82448675-82448697 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823400 17:82448756-82448778 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1152823416 17:82448837-82448859 AGGTCTGAGGACCAGGGAGGAGG + Intronic
1155257822 18:24014360-24014382 CGGACCCAGGAGTCGGGAGGAGG - Intronic
1155300724 18:24426707-24426729 CGCGCTCCGGACCTGGCAGGCGG + Exonic
1156350440 18:36297670-36297692 CGGGCTCCGGCCGCGGGGGGCGG - Intergenic
1158415395 18:57245929-57245951 TGGGCTCAGAATCAGGGAGGTGG + Intergenic
1158430213 18:57378451-57378473 TGGGCTAAGGAACCAGGAGGGGG - Intergenic
1160631259 18:80247571-80247593 CGGGCGCGGGCGCCGGGAGGTGG - Intergenic
1160698745 19:496614-496636 GGGGCTCAGGAGAGGGGAGGGGG + Intronic
1160698882 19:496999-497021 GGGGCTCAGGAGAGGGGAGGGGG + Intronic
1160806668 19:995036-995058 AGGGCTCAGGACCAGGCAGGAGG + Intronic
1160831136 19:1105306-1105328 CGGGGTCGGGCCCTGGGAGGGGG + Intronic
1160901925 19:1433076-1433098 CGGGGTCTGGACCCAGCAGGAGG - Intronic
1160980504 19:1814564-1814586 AGGGCACAGGTCCCGGGATGAGG - Intergenic
1161327830 19:3671956-3671978 CGCGCTGCGGAGCCGGGAGGTGG + Intronic
1161619979 19:5292822-5292844 CTGGCTCCGCCCCCGGGAGGTGG + Intronic
1161857379 19:6773460-6773482 GGGGCCCAGGGCCCGGGAGGAGG - Intronic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1162535644 19:11261859-11261881 TGGGCACTGGACCCTGGAGGGGG + Intronic
1162561188 19:11418960-11418982 TGTCCTCAGGACCTGGGAGGAGG - Intronic
1162722333 19:12669921-12669943 CGATCTCAGGAGGCGGGAGGAGG - Exonic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1165461221 19:35945297-35945319 CAGTCTGAGGACCCCGGAGGAGG + Exonic
1166007329 19:39916522-39916544 GAGGGTGAGGACCCGGGAGGAGG - Intronic
1166096451 19:40542342-40542364 CGTGGCCAGGACCTGGGAGGTGG - Intronic
1166187145 19:41147963-41147985 TTGGACCAGGACCCGGGAGGCGG + Intergenic
1167353812 19:48991706-48991728 TGGGGTCAGGACCCTGAAGGAGG + Intronic
1167625908 19:50589016-50589038 CGCTCCCAGAACCCGGGAGGCGG + Intergenic
1167674762 19:50877399-50877421 CGGGCTCTGGGGCAGGGAGGAGG + Intronic
1168072000 19:53958577-53958599 GGGGCTGGGGACGCGGGAGGGGG + Intergenic
926889522 2:17627146-17627168 CTGCCTCAGGGCCCTGGAGGAGG + Intronic
928049092 2:27969677-27969699 GGGGCTCGGGACGGGGGAGGAGG + Intronic
929936442 2:46297422-46297444 CGGGCACCGGACCCGTGTGGCGG - Exonic
932798151 2:74715591-74715613 CGGGCTCAGGTCCTCGGTGGCGG - Intergenic
935740137 2:106140176-106140198 CTGGCTCAGCCCCCGGGAGCTGG + Intronic
936388961 2:112055073-112055095 CGGGCTCGGGACTGTGGAGGCGG - Intergenic
936396899 2:112138371-112138393 TGGGCTAAGGACGAGGGAGGAGG - Exonic
937208590 2:120252896-120252918 TGGGGTCCGGCCCCGGGAGGGGG + Exonic
937463340 2:122108422-122108444 TGGGCTCTGGTCCTGGGAGGTGG + Intergenic
938305467 2:130251637-130251659 CTGGGGCAGGACCTGGGAGGGGG - Intergenic
944833372 2:203555074-203555096 TGGACTCAGAACCCGGGAGAGGG + Intergenic
946329657 2:219002110-219002132 CGGTCTCAGAGCCCGGGCGGGGG - Intergenic
946339576 2:219059045-219059067 CGGGCTCTGGACCCGAGAGGGGG - Intronic
947919012 2:233853955-233853977 GGGGCCCCAGACCCGGGAGGAGG + Intronic
948198488 2:236112674-236112696 GGGGCTCAGGAGGCAGGAGGCGG + Intronic
948467381 2:238158872-238158894 CGCGCACGGGAGCCGGGAGGGGG + Intergenic
948529527 2:238595489-238595511 CAGGCTCAGGTCCCAGGAAGAGG - Intergenic
948567915 2:238898123-238898145 CGGTCTCAGGGCCCGGGTGCTGG + Intronic
948597260 2:239087967-239087989 CGGGACCAGGACCCGCTAGGTGG + Intronic
948777867 2:240299239-240299261 CAGGCTGAGGAGCCCGGAGGAGG - Intergenic
948800157 2:240429838-240429860 ACGGCTGAGGACCAGGGAGGAGG - Intergenic
948830185 2:240594832-240594854 CTGTCCCAGGAGCCGGGAGGAGG + Intronic
1169367093 20:5001016-5001038 CGGGCGCAGAGCCCGGGAGGAGG + Intronic
1171445065 20:25196900-25196922 CGGGTAAAGGACCAGGGAGGTGG + Intronic
1172699898 20:36846621-36846643 CTGGCTCAGGACCCGGTAAGGGG - Intronic
1172753062 20:37264470-37264492 ATGGCTCAGGACCCAGGAGGCGG + Intergenic
1173734193 20:45348082-45348104 GGGGCTGAGGCCCGGGGAGGCGG + Intronic
1173952118 20:47001626-47001648 AGGGCTCAGGCCCAGGGAGGTGG - Intronic
1174406629 20:50307038-50307060 CAGGCTCAGGAGCTGGGAGTGGG + Intergenic
1175190891 20:57211518-57211540 TGGGATCAGGGCCTGGGAGGTGG - Intronic
1175492964 20:59391178-59391200 AGGGCACTGGAGCCGGGAGGTGG + Intergenic
1175965800 20:62659644-62659666 CGGGGTCTGGCCCCCGGAGGCGG + Intronic
1175997297 20:62817484-62817506 GCCGCTCGGGACCCGGGAGGAGG + Intronic
1176077517 20:63254997-63255019 CGGGCCGAGGACTCAGGAGGAGG + Intronic
1176088770 20:63309791-63309813 CTGGCTCAGGACCAGGCTGGTGG - Exonic
1176097910 20:63352772-63352794 CGGGCAGAGGACCCTGGGGGAGG - Intronic
1176222253 20:63975261-63975283 TGGGCTCAGGTCCCAGGAGGTGG + Exonic
1177225315 21:18245411-18245433 TGGTGTAAGGACCCGGGAGGAGG + Intronic
1179106228 21:38403239-38403261 TGGTCGCAGGACCCTGGAGGAGG + Intronic
1179145739 21:38765897-38765919 ATGGCTCAGGAGCCTGGAGGGGG + Intergenic
1179472158 21:41618487-41618509 CGTGCTCAGGACACGGATGGAGG + Intergenic
1180051824 21:45335151-45335173 GGGGCACAGGTCCGGGGAGGGGG - Intergenic
1180051841 21:45335189-45335211 GGGGCACAGGTCCGGGGAGGGGG - Intergenic
1180051949 21:45335452-45335474 GGGGCACAGGTCCGGGGAGGGGG - Intergenic
1180051982 21:45335527-45335549 GGGGCACAGGCCCGGGGAGGGGG - Intergenic
1180960542 22:19760596-19760618 CGGGCTGGGGGCCGGGGAGGGGG + Intronic
1181047880 22:20224150-20224172 CGGGCGCAGGAGCCGAGCGGTGG + Intergenic
1181335763 22:22126423-22126445 CTGGCTCAGGAGCCAGCAGGAGG - Intergenic
1181360058 22:22327497-22327519 TGGGCCCAGGACCCTGGAAGTGG - Intergenic
1181370281 22:22409963-22409985 TGGGCCCAGGACCCTGGAAGTGG - Intergenic
1182685439 22:32119542-32119564 CTGGCTCAGGCCCCAGAAGGAGG + Intergenic
1183465838 22:37980048-37980070 TGGGCTCAGGGCCGGGGTGGGGG - Intronic
1183508755 22:38223159-38223181 GGGGCTCAGGACCAGTGGGGAGG + Intronic
1183586403 22:38755604-38755626 CGGGCCGCGGACCCGGGTGGAGG + Intronic
1184053425 22:42026804-42026826 GGGGCTCCGTATCCGGGAGGTGG - Exonic
1185277350 22:49955523-49955545 TGGGCACAGACCCCGGGAGGAGG - Intergenic
1185301622 22:50083974-50083996 CATGCTCAGGCCACGGGAGGTGG + Intronic
949556424 3:5157378-5157400 CAGGCTCAGGACCAGGAAGTGGG - Intronic
950438267 3:12993403-12993425 CAGGCTCGGGACCCTGGACGCGG + Intronic
952900808 3:38110450-38110472 CCCACTCAGGGCCCGGGAGGTGG - Intronic
953137229 3:40191564-40191586 GGGCCTCAGGACCAGGGATGTGG - Intronic
954445092 3:50542168-50542190 AGGGCTCAGCACCAGGGTGGTGG - Intergenic
955060530 3:55488590-55488612 CGGGCTGGGGTGCCGGGAGGCGG + Intronic
961299919 3:125915993-125916015 GGGGCCCAGGGTCCGGGAGGCGG - Intergenic
961513894 3:127420964-127420986 CAGGCACAGGGCCCCGGAGGGGG + Intergenic
961679968 3:128593050-128593072 CGGGGTCAGGCCACGGGAGGAGG + Intergenic
961888590 3:130112080-130112102 GGGGCCCAGGGTCCGGGAGGCGG + Intronic
961888717 3:130112440-130112462 CGGGTTTGGGGCCCGGGAGGCGG + Intronic
962205051 3:133427562-133427584 CTGGCTGAGGAGCAGGGAGGTGG - Intronic
965296782 3:166956916-166956938 CAGGTCCAGGACCAGGGAGGTGG - Intergenic
966593989 3:181710729-181710751 GGGGCTCAAGGCCTGGGAGGCGG - Intergenic
966686262 3:182698921-182698943 GAGGCTGAGGACCCAGGAGGTGG + Intergenic
968471463 4:784548-784570 CGGGTCCAGGACTCAGGAGGAGG + Intergenic
968556460 4:1248525-1248547 CGGGGTCATGACCGGGGACGGGG + Intronic
968764709 4:2462404-2462426 CGGGCTCAGGAGCAGGCCGGCGG - Intronic
968997855 4:3956347-3956369 CGGGTTTGGGGCCCGGGAGGCGG + Intergenic
969057925 4:4413698-4413720 CAGGCACAGGCCCCTGGAGGAGG + Intronic
969465567 4:7354331-7354353 CAGGCTCTGGACCTGGGAGCCGG - Intronic
969502937 4:7564641-7564663 CGAGCTCACCAGCCGGGAGGTGG + Intronic
969525376 4:7701530-7701552 CGGCCTCAGGGCCCCGAAGGAGG - Intronic
969714558 4:8861963-8861985 CGGGCTGGGGAGCCGGGAGGCGG + Intronic
969756142 4:9152308-9152330 CGGGTTTGGGGCCCGGGAGGCGG - Intergenic
969756272 4:9152665-9152687 GGGGCCCAGGGTCCGGGAGGCGG - Intergenic
969759172 4:9170014-9170036 CTGGCTCAACTCCCGGGAGGAGG - Intergenic
969816468 4:9691473-9691495 CGGGTTTGGGGCCCGGGAGGCGG - Intergenic
969816600 4:9691863-9691885 GGGGCCCAGGGTCCGGGAGGCGG - Intergenic
973360646 4:49161484-49161506 CGGGCTGCGGACCCTGGCGGGGG + Intergenic
975574654 4:75850596-75850618 GGAGCTCTGAACCCGGGAGGCGG + Intergenic
976207892 4:82639639-82639661 CAGGCTGAGGACCTGGGAGCTGG + Intronic
978127163 4:105147824-105147846 CAGGCGCAGGCCCGGGGAGGGGG + Intronic
982484760 4:155953701-155953723 CGCGCTCGGTACCCGGAAGGCGG + Exonic
983807532 4:172013846-172013868 GGGGCTCAGGAGCTGGGGGGTGG - Intronic
986813667 5:11385187-11385209 CGGGCTCGGGCCCCGCCAGGTGG + Exonic
989011378 5:36876597-36876619 CGGGCCCAGCAGCCGGGAGGCGG - Intergenic
997295659 5:132766764-132766786 CGGGGTCAGGAACCGACAGGGGG + Intronic
1002355538 5:178626446-178626468 GGTGCCCAGGAGCCGGGAGGTGG - Intronic
1002418773 5:179134860-179134882 CGGGAGCTGGACCCGGGAGCTGG - Intronic
1002418843 5:179135059-179135081 CGGGAGCTGGACCCGGGAGCTGG - Intronic
1002467243 5:179413753-179413775 AGGGCACAGCACCCGGGAGCCGG + Intergenic
1002541171 5:179907534-179907556 CGAGGCCAGGACCCGGGAGCCGG - Intronic
1002594312 5:180312175-180312197 GAGGCTGAGGACCAGGGAGGCGG + Intronic
1002701374 5:181127592-181127614 CAGGCCCAGGACCCTGGAGATGG + Intergenic
1003199810 6:3948966-3948988 GGGACTCAGGACCAGGTAGGTGG + Intergenic
1006305161 6:33214191-33214213 AGGACTGGGGACCCGGGAGGGGG - Intergenic
1006406539 6:33848889-33848911 GGGGCACAGGACCCGGCAGCGGG - Intergenic
1007416122 6:41692276-41692298 CTGGCTCAGGACCTGGGACATGG + Intronic
1007736838 6:43987223-43987245 TAGGCTCAGGAGCCAGGAGGTGG - Intergenic
1008092810 6:47309598-47309620 TGGGCTCCCGGCCCGGGAGGCGG - Exonic
1016438874 6:144064061-144064083 AGAGCACAGGACCCGGGAGGCGG + Intronic
1017008607 6:150046334-150046356 TGGGTTCAGGACACAGGAGGGGG + Intergenic
1017164114 6:151391380-151391402 TGGGCACCGGCCCCGGGAGGCGG + Intronic
1018797309 6:167196390-167196412 AGGGCTCCAGACCCGGGTGGGGG + Intronic
1018818988 6:167358374-167358396 AGGGCTCCAGACCCGGGTGGGGG - Intronic
1018863673 6:167731486-167731508 GGGGCTCAGAACGCCGGAGGTGG + Intergenic
1019316102 7:387659-387681 AGGGCTCAGGACCAGGGAAACGG - Intergenic
1019606846 7:1914178-1914200 AGGCCTCAGGACCTGGGAGTCGG + Intronic
1019630495 7:2046384-2046406 CGGGCGCCGGGCCTGGGAGGAGG - Intronic
1019685897 7:2382046-2382068 CGGGCTCAGGACATCGGGGGGGG + Intergenic
1020026373 7:4902863-4902885 TGGGCTCAGGAAGTGGGAGGTGG - Intergenic
1025615639 7:63114179-63114201 AGGGCCCAGGGCCAGGGAGGCGG - Intergenic
1029061832 7:97806403-97806425 CGTGCTCAGGAGCCAGGAGCAGG - Intergenic
1029440270 7:100583448-100583470 GGGGCCCAGGGCCCGCGAGGCGG + Intronic
1029440600 7:100584900-100584922 GGGGATCAGGATCAGGGAGGAGG - Intronic
1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG + Exonic
1029548068 7:101221823-101221845 AGGGCTCAGGTCCAAGGAGGAGG + Intronic
1029708307 7:102286771-102286793 CGGGGCCAGGACGCGCGAGGGGG + Intronic
1032216259 7:129959735-129959757 CGGGCTCCGAACAGGGGAGGTGG - Intergenic
1033599471 7:142878266-142878288 TGGTCCCAGGACCCGGTAGGGGG - Intronic
1034162115 7:149001578-149001600 CCGACTCAGGAGCTGGGAGGAGG - Intergenic
1034553339 7:151834809-151834831 CGGGCTCCGGAACTGGGAGATGG - Intronic
1034553917 7:151837976-151837998 CACGCACAGGACCCTGGAGGAGG + Intronic
1034553930 7:151838019-151838041 CGCGCACAGGACCCCGGAGGAGG + Intronic
1035175453 7:157046805-157046827 GGGGCACAGGAGCTGGGAGGAGG - Intergenic
1036850045 8:12194642-12194664 GGGGCCCAGTGCCCGGGAGGCGG + Intergenic
1036871409 8:12436915-12436937 GGGGCCCAGGGCCCGGGAGGCGG + Intergenic
1037899788 8:22681138-22681160 TGGGCTCAGGGCCCGGGATATGG + Intergenic
1040067730 8:43161859-43161881 AGGGCTCAGGGCCAGAGAGGGGG - Intronic
1040386520 8:46918169-46918191 CGGGTTCACGACCCTGGGGGGGG + Intergenic
1040538065 8:48326970-48326992 TGGGCCCAGGACCCGGGGGAGGG + Intergenic
1041673727 8:60517288-60517310 CGGCCTCCGGACCCGGGCTGAGG + Intronic
1042965814 8:74350679-74350701 CGGGGTCAGGACACTGGAGGCGG - Intronic
1044666558 8:94639543-94639565 GGGGTTCAGCTCCCGGGAGGGGG - Intergenic
1045737934 8:105318525-105318547 GGGGCGCAGGGCGCGGGAGGAGG - Intronic
1049410393 8:142471402-142471424 CGGGGTCGGGGCCCGGGCGGTGG + Intronic
1049457520 8:142701015-142701037 GGGGGGCAGGACCTGGGAGGTGG + Intronic
1049616337 8:143577301-143577323 CGGGCTCAGGGCCCCGATGGGGG - Exonic
1049687564 8:143945022-143945044 CGGGCTCACGTCCCTGCAGGAGG + Intronic
1049766622 8:144358177-144358199 CGGGCTCAGGTCCGAGGCGGCGG - Exonic
1051171569 9:14322707-14322729 GGCGCCCGGGACCCGGGAGGCGG + Intronic
1053786340 9:41655239-41655261 CGGGGTCCGGGGCCGGGAGGCGG + Intergenic
1057034801 9:91804225-91804247 CAGGCTCAGGAACTGGCAGGAGG + Intronic
1057135121 9:92682077-92682099 CAGGCTCGAGACCCAGGAGGAGG - Intergenic
1057930678 9:99190399-99190421 TGGGCTCTGGACCAAGGAGGAGG - Intergenic
1059328187 9:113517478-113517500 CTGGGTGAGGACCCGGGGGGAGG - Intronic
1061118177 9:128627642-128627664 CGGGCTCTGGAGCCGGGAGTGGG + Intronic
1061866507 9:133494170-133494192 GGGGCACAGGACCCGGGACATGG + Intergenic
1062162560 9:135088191-135088213 GGGGCTCCGGACCGAGGAGGGGG - Intronic
1062609967 9:137369214-137369236 GGGGCGCAGGGCCTGGGAGGTGG + Intronic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062694628 9:137867095-137867117 CTTTCTCAGGACCCAGGAGGTGG - Intronic
1185621482 X:1453399-1453421 CGGGGACGGGGCCCGGGAGGCGG - Intronic
1185641477 X:1591511-1591533 CTGGCTCCGCCCCCGGGAGGAGG - Intergenic
1185685301 X:1923722-1923744 AGGGTTCAGAACCCGGCAGGTGG + Intergenic
1186977370 X:14922786-14922808 CATGCTCAGGACCCGGGACCTGG + Intergenic
1187669758 X:21656909-21656931 GGGGCGCAGGGCACGGGAGGTGG - Exonic
1190061152 X:47212522-47212544 GGGGCTCAGGACAGGGAAGGAGG + Intronic
1190110452 X:47585937-47585959 GGGGCTCAGGAACGGGGAGTGGG - Intronic
1190691602 X:52917411-52917433 AGGGCTCAGGTCCTGGGAAGTGG + Intergenic
1190694381 X:52938381-52938403 AGGGCTCAGGTCCTGGGAAGTGG - Intronic
1191104571 X:56764478-56764500 AGGGCTCAGAACCCCGGTGGGGG + Intergenic
1193360605 X:80574647-80574669 CGGGGGCACGAGCCGGGAGGCGG + Intergenic
1193923278 X:87455391-87455413 CGGGCTGAGGCCCTGGGAGAGGG - Intergenic
1198214912 X:134546544-134546566 CCGGCTCAGGAGCAGGTAGGTGG - Intergenic
1199642896 X:149881259-149881281 CGGGCTCAGGGTCTGTGAGGAGG + Exonic