ID: 1029539498

View in Genome Browser
Species Human (GRCh38)
Location 7:101174307-101174329
Sequence CTATGTCAGTGAGGGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029539498_1029539509 11 Left 1029539498 7:101174307-101174329 CCACCCCACCCTCACTGACATAG 0: 1
1: 0
2: 4
3: 34
4: 350
Right 1029539509 7:101174341-101174363 GCACTGCACGCCCTGCACTTTGG 0: 1
1: 0
2: 0
3: 15
4: 188
1029539498_1029539512 23 Left 1029539498 7:101174307-101174329 CCACCCCACCCTCACTGACATAG 0: 1
1: 0
2: 4
3: 34
4: 350
Right 1029539512 7:101174353-101174375 CTGCACTTTGGTCCCAAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029539498 Original CRISPR CTATGTCAGTGAGGGTGGGG TGG (reversed) Intronic
900326438 1:2110711-2110733 CCCTGTGAGTGTGGGTGGGGTGG + Intronic
900457857 1:2786107-2786129 CTGGGGCAGTGAGGGTGGGGTGG - Intronic
900899206 1:5505436-5505458 CCATGTTAGTCAGGGTGGGCTGG - Intergenic
901621275 1:10589846-10589868 CAATGCCAGTGAGGGTGCTGTGG - Intronic
902295602 1:15464765-15464787 CTGAGACAGTGAGAGTGGGGAGG + Intronic
902298495 1:15484667-15484689 CTGAGACAGTGAGAGTGGGGAGG + Intronic
902629127 1:17694461-17694483 CAATGTCAGAGAGGGCGTGGGGG - Intronic
902838981 1:19063497-19063519 CTGTCTCAGTGAGGGTGCAGTGG + Intergenic
902959457 1:19952364-19952386 CTAATTCAGTAAGTGTGGGGTGG - Intergenic
904446887 1:30581004-30581026 CTCTGTCACCGAGGCTGGGGTGG + Intergenic
905537667 1:38735879-38735901 CAATGGTAGTGAGGATGGGGAGG + Intergenic
906064569 1:42971159-42971181 CCATGTCAGGCCGGGTGGGGTGG + Intergenic
907487249 1:54786647-54786669 CTATGCCACTGGGGGTGGAGAGG + Intronic
907997120 1:59644154-59644176 CTGAGTCAGTTAGGGTGGGAAGG - Intronic
909419808 1:75450904-75450926 CTAAGTCAGGAAAGGTGGGGTGG - Intronic
913167713 1:116203833-116203855 CTATGTAGGAGAGGGTGGAGAGG - Intergenic
914066123 1:144247744-144247766 CTGGGACTGTGAGGGTGGGGGGG - Intergenic
914113030 1:144718610-144718632 CTGGGACTGTGAGGGTGGGGGGG + Intergenic
915296772 1:154926947-154926969 CTAAGACAGGGAAGGTGGGGAGG - Intronic
916296440 1:163225589-163225611 ATATGTGAGTGTGTGTGGGGTGG - Intronic
916932512 1:169593524-169593546 TTATGTAATTTAGGGTGGGGAGG - Intronic
920338447 1:205260174-205260196 CTATCTCAGGCAGGTTGGGGTGG + Intronic
920542085 1:206786448-206786470 CTGTGTGAGTGAGGGTTGGCTGG + Intergenic
921160466 1:212468704-212468726 CTAAGGCGGTGGGGGTGGGGGGG - Intergenic
921209814 1:212885137-212885159 ATGTGTCAGTGTGGGAGGGGAGG - Intronic
921539784 1:216399350-216399372 CTCACTTAGTGAGGGTGGGGTGG - Intronic
923369686 1:233297487-233297509 GTAAGTCTGTGAGGGAGGGGTGG + Intergenic
924287689 1:242505120-242505142 CTTTGTCACTGAGGCTGGAGTGG - Intronic
1063031157 10:2236793-2236815 CTCTGTCACTGAGGAAGGGGAGG + Intergenic
1063891898 10:10638873-10638895 CTTTGCCAGTCAGGGTGAGGTGG - Intergenic
1064137961 10:12766743-12766765 TCCTGTCAGTGGGGGTGGGGTGG + Intronic
1064571575 10:16698899-16698921 GTAAGTAAATGAGGGTGGGGAGG - Intronic
1067182386 10:43998381-43998403 GAATCTCAGTGAGGGTGTGGAGG + Intergenic
1068017009 10:51529646-51529668 CTATTTCAGTGAGGGGGGTCAGG - Intronic
1068130031 10:52885325-52885347 CGCTGGCAGTGAGGGTGGGGTGG + Intergenic
1071531597 10:86393575-86393597 CTGTGGCAGCAAGGGTGGGGCGG + Intergenic
1072754704 10:98011503-98011525 CAGTTTCAATGAGGGTGGGGAGG - Intronic
1072802778 10:98404984-98405006 GAAGGTCAGTGAGGGAGGGGAGG + Intronic
1072898086 10:99384489-99384511 GTATGGCAGTGAGGGTGGGGAGG - Intronic
1074228776 10:111513312-111513334 CTTTGTCAGAGAAGGTGGGTAGG + Intergenic
1074896067 10:117778634-117778656 CCATGTCAGTCTGGGTTGGGGGG - Intergenic
1075370089 10:121928179-121928201 CGTCGTCAGTGAGGGTGAGGCGG + Intronic
1076436685 10:130451069-130451091 ATCTGTCAGTGAAAGTGGGGAGG - Intergenic
1076478332 10:130767745-130767767 CTGAGGCCGTGAGGGTGGGGGGG + Intergenic
1076674910 10:132142693-132142715 CTCAGTAAGGGAGGGTGGGGCGG - Intronic
1076803839 10:132845405-132845427 CTTTGCTGGTGAGGGTGGGGCGG - Intronic
1077130829 11:971575-971597 CTGGGTCAGTGGGGGTGGAGGGG + Intronic
1077603031 11:3586997-3587019 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
1078060318 11:8039085-8039107 TGAGGTCAGTGAGGGTGGGTGGG - Intronic
1078075313 11:8154220-8154242 TTATCTCAGAGAGGGTGTGGGGG - Intronic
1078113218 11:8417803-8417825 CTGTGTCGGTGAGGGTGTGGAGG + Intronic
1079069405 11:17329810-17329832 ATGTTTCAGTGAGGGTTGGGGGG + Intronic
1079403851 11:20128217-20128239 CTATGTCCCTGAGGGTGGATAGG - Intergenic
1080329225 11:31115972-31115994 CTGTGGCAGTGGGGGGGGGGGGG + Intronic
1080687381 11:34526478-34526500 CTATTTTAGAGAGGGTGGTGAGG - Intergenic
1081809634 11:45907666-45907688 CCATGCCAGTGGGGGTGGGGGGG - Intergenic
1081930049 11:46863144-46863166 CTATGTGAGTGAGTGTGGAAGGG + Intronic
1081950807 11:47040918-47040940 CTATGGCAGCGGTGGTGGGGAGG + Intronic
1083335251 11:61918136-61918158 GTGTGTCGGTGGGGGTGGGGTGG - Intronic
1083633170 11:64106069-64106091 CCATATCAGTGGGGGTGAGGAGG + Intronic
1083832316 11:65240635-65240657 CCATCTCAGTGGGGTTGGGGTGG + Intergenic
1084107175 11:66987667-66987689 CCATGAGAGTGAGGGTGGGGAGG - Intergenic
1084258911 11:67961535-67961557 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
1084285769 11:68129511-68129533 AGATGTCAGTGAGGGTGGCAAGG - Intergenic
1084549780 11:69834425-69834447 CTCTGTCAGAGAGGGAAGGGTGG - Intergenic
1084813838 11:71633643-71633665 CTGTGGCAGTGAGGATGGAGAGG - Intergenic
1084894847 11:72258566-72258588 CTAGGGTTGTGAGGGTGGGGTGG + Intergenic
1087764207 11:102132322-102132344 CAATGTCATTCAAGGTGGGGAGG - Intronic
1088918568 11:114245201-114245223 CTCTGGCAGTGAGGATGGGCAGG + Intronic
1089051676 11:115550920-115550942 TTATGGCAGGGAGGGAGGGGAGG + Intergenic
1090267697 11:125363843-125363865 CTCTGGGAGTGGGGGTGGGGAGG + Intronic
1091448139 12:556524-556546 CTATGGCAGAAAGTGTGGGGAGG - Intronic
1092285993 12:7129636-7129658 GTATTTCTGTGAAGGTGGGGTGG + Intergenic
1092886719 12:12930794-12930816 CTATGTCAGTCAGGATGGGCTGG + Intergenic
1093015015 12:14146895-14146917 CTCTGTCACTCAGGGTGGAGTGG - Intergenic
1094429409 12:30350311-30350333 CACTGTCTGTGTGGGTGGGGGGG + Intergenic
1094817885 12:34204917-34204939 GTGTGTCTGTGGGGGTGGGGTGG + Intergenic
1095601144 12:44014264-44014286 CTTTGTCACTGAGGGTGGTATGG + Intronic
1096257752 12:50073402-50073424 CTGTGGCAGTGTGGCTGGGGCGG - Intronic
1096591445 12:52662574-52662596 TTAGGTGAATGAGGGTGGGGAGG - Intergenic
1097989224 12:65817649-65817671 CTAAGGCAGTGACAGTGGGGTGG + Intergenic
1098391296 12:69972218-69972240 CTATTTCAGTGGGTCTGGGGTGG + Intergenic
1098429197 12:70401365-70401387 CTAAGACAGTGATAGTGGGGAGG - Intronic
1103085564 12:118060410-118060432 TTAAGTCAGTGGAGGTGGGGCGG - Intronic
1103281995 12:119766059-119766081 CCCTGTCAGCGGGGGTGGGGTGG + Intronic
1103746891 12:123130968-123130990 CTAGGCATGTGAGGGTGGGGTGG - Intronic
1104835372 12:131786719-131786741 CCATGCCACTGGGGGTGGGGGGG - Intronic
1106204569 13:27578915-27578937 TTATGTCAGTGTGTCTGGGGTGG + Intronic
1106307974 13:28530491-28530513 CTTTCTCATCGAGGGTGGGGTGG + Intergenic
1106436437 13:29727357-29727379 CAAAGGCAGTGAGGGTGGAGAGG + Intergenic
1106451299 13:29885215-29885237 TTATGTCATTGGAGGTGGGGTGG + Intergenic
1106567696 13:30900565-30900587 CAATGGCAGTGGGGGTGGGAAGG + Intergenic
1107029506 13:35836280-35836302 CAATGTCAGCAAGGGTGGGGAGG - Intronic
1107275509 13:38674040-38674062 CTTTGTCAGTGTGGGTGAGTAGG - Intergenic
1108526434 13:51289524-51289546 TTATGTCAGGTAGGGTGTGGTGG + Intergenic
1109112837 13:58344928-58344950 CTTTCTCACTGGGGGTGGGGAGG - Intergenic
1109684711 13:65802671-65802693 CTATGGCACTGATGGTGGAGAGG - Intergenic
1110597299 13:77333583-77333605 CTACCTCAGTGTTGGTGGGGTGG + Intergenic
1110742965 13:79018968-79018990 CTATGTCAGAAAGGGTAGAGTGG + Intergenic
1112364722 13:98747030-98747052 CTGTGTCAGCCGGGGTGGGGGGG - Intronic
1112468557 13:99667363-99667385 CTATGTGTATGTGGGTGGGGAGG - Intronic
1113241280 13:108340410-108340432 CTGAGACAATGAGGGTGGGGTGG - Intergenic
1113245861 13:108394619-108394641 CTATGTGTGTGTGGGGGGGGAGG - Intergenic
1113740961 13:112712138-112712160 GTGTGTCACTCAGGGTGGGGAGG - Intronic
1114329974 14:21627021-21627043 CTTAGTCACTGAGTGTGGGGAGG + Intergenic
1115029347 14:28775274-28775296 TTATGTTTGTGAGGGTGGGAGGG + Intronic
1115337898 14:32260317-32260339 CTATATCTGTGAGGTGGGGGTGG + Intergenic
1115366390 14:32562302-32562324 GTATGTGTGTGTGGGTGGGGAGG + Intronic
1115658636 14:35468087-35468109 CTGAGGCAGTGGGGGTGGGGGGG + Intergenic
1116228053 14:42178556-42178578 CTATTTAAGTGTGTGTGGGGGGG - Intergenic
1117966604 14:61213030-61213052 TTATGTCAGGGAGAGAGGGGTGG + Intronic
1118838795 14:69495791-69495813 CCATGTCAAAGAGGGTGGGCAGG - Intronic
1120169042 14:81230941-81230963 CTATGCCATTTAGGGTGGGGAGG - Intergenic
1120238798 14:81925345-81925367 AGATATGAGTGAGGGTGGGGTGG + Intergenic
1121793525 14:96717299-96717321 CATTGTCAGTGGGGTTGGGGGGG - Intergenic
1122689506 14:103525111-103525133 CTATTTCAGTGAGGGGGATGTGG + Intergenic
1123627905 15:22239906-22239928 AGATGTGAGGGAGGGTGGGGAGG + Intergenic
1123971052 15:25508082-25508104 CTATGGCTGTGCAGGTGGGGCGG + Intergenic
1124624700 15:31301195-31301217 CAAAGGCAGTGGGGGTGGGGAGG - Intergenic
1125317634 15:38448266-38448288 CTATGTTTGGGAGGGTGGTGAGG + Intergenic
1125488601 15:40129524-40129546 CAATATCACTGGGGGTGGGGGGG + Intergenic
1125908719 15:43417189-43417211 ATATGTGTGTGGGGGTGGGGGGG - Intronic
1126568565 15:50126121-50126143 ATATTTCAGTGTGGGTGTGGAGG + Intronic
1129419946 15:75416715-75416737 TTAGGTCTGTGAAGGTGGGGAGG - Intronic
1129483531 15:75845653-75845675 TTATCCCAGTGGGGGTGGGGTGG + Intronic
1129699413 15:77759022-77759044 CTTACTCAGGGAGGGTGGGGTGG - Intronic
1130715435 15:86329283-86329305 CTATGTCCATGAGGGTGGGGTGG - Intronic
1133233799 16:4378535-4378557 CTGAGTCAGTGAGGGTGGAGCGG + Intronic
1133365951 16:5210330-5210352 CTGTGGCAGTGAGGATGGAGAGG - Intergenic
1133653045 16:7831056-7831078 TTATTTTATTGAGGGTGGGGAGG + Intergenic
1134249734 16:12565942-12565964 CAGTGTCATTGAGGATGGGGAGG - Intronic
1134288207 16:12880732-12880754 CTCTGTCACCCAGGGTGGGGTGG - Intergenic
1135526366 16:23216306-23216328 CTGTGTCACTTTGGGTGGGGAGG + Exonic
1135894906 16:26390661-26390683 CTATGACAATGATTGTGGGGAGG + Intergenic
1136857935 16:33676186-33676208 CTCTGTCAGGGGGGGTGGGGGGG + Intergenic
1137494768 16:48961291-48961313 TTATGTCAGTGGGGGTGGGGGGG + Intergenic
1137600982 16:49756081-49756103 GTTTGTGAGTGAGGGAGGGGAGG + Intronic
1137855423 16:51789906-51789928 CGTTGTCAGGGAGGGTGGGAAGG + Intergenic
1140342986 16:74183777-74183799 CCTTGTCATTGAGGGTGGGAAGG - Intergenic
1140357338 16:74317869-74317891 CTCTGTCACTGAGGGTGCAGTGG + Intergenic
1140865724 16:79060143-79060165 CTTGGGCAGTGGGGGTGGGGAGG + Intronic
1141103650 16:81215717-81215739 CTCTGTCACTGAGGCTGGAGTGG - Intergenic
1142714137 17:1738797-1738819 CCAGGACAGTGAGGGTGGGAAGG + Intergenic
1142769202 17:2084455-2084477 CTATGTCATCAGGGGTGGGGTGG + Intronic
1143034630 17:3987304-3987326 TTGTGTCTGGGAGGGTGGGGAGG - Intergenic
1143080358 17:4376937-4376959 CTCTGTCACTGAGGCTGGAGTGG + Intergenic
1143426700 17:6845184-6845206 TGCTGGCAGTGAGGGTGGGGAGG - Intergenic
1143498861 17:7327405-7327427 CTAGGGCAGTGGTGGTGGGGTGG - Intronic
1143972028 17:10802983-10803005 GAGTGTGAGTGAGGGTGGGGTGG + Intergenic
1144772876 17:17769635-17769657 CTGTGGCAGTGAGGATGGGGAGG + Intronic
1146537875 17:33668734-33668756 CTATGTCAGAGATGGTTGTGAGG + Intronic
1147250832 17:39151660-39151682 CTGGGTCGGTGGGGGTGGGGGGG + Intronic
1147561732 17:41513514-41513536 CCAGGGAAGTGAGGGTGGGGAGG - Intergenic
1148013678 17:44505714-44505736 CAATGGGAGTGAGGGTAGGGAGG + Intergenic
1148127851 17:45246044-45246066 CTGTAACAGTGAGGGTGTGGGGG - Intronic
1148524156 17:48313849-48313871 CTATGTGTGTGATGGTGGGGAGG + Intronic
1149012398 17:51871091-51871113 CTCTGTCACTCAGGGTGGAGTGG + Intronic
1149171946 17:53822772-53822794 CTCTGCCAGTGAGGGTGAAGGGG - Intergenic
1151442001 17:74135603-74135625 CACTGAAAGTGAGGGTGGGGAGG + Intergenic
1151954052 17:77371997-77372019 ATATTTCAGAGGGGGTGGGGAGG + Intronic
1152037302 17:77881220-77881242 CTTTGTCACTGGGGGTGGTGGGG - Intergenic
1152335576 17:79698709-79698731 CCAAGTCAGAGAGGGTGGAGGGG - Intergenic
1153289473 18:3486198-3486220 CCATGTCAGTCAGGCTGGTGTGG - Intergenic
1155584251 18:27346725-27346747 TTATGTCAGAGAGGGTTGGATGG - Intergenic
1155906482 18:31458371-31458393 CTATGGAAGTGGGGGTGGAGAGG + Intronic
1156190194 18:34710162-34710184 CTTTGTCAGGGTGGGTGGAGGGG + Intronic
1156890930 18:42188430-42188452 CTATTTCACTGGGGGTGGGAGGG - Intergenic
1156915544 18:42461983-42462005 ATGTATCAGTTAGGGTGGGGTGG - Intergenic
1157157406 18:45281370-45281392 TTATGGCAGTGATGGTGTGGCGG - Intronic
1157840689 18:50955644-50955666 AAATGTCTGTGAAGGTGGGGAGG - Intergenic
1157959197 18:52133631-52133653 GTATGCCGGTGGGGGTGGGGGGG + Intergenic
1157988175 18:52463516-52463538 CTATGTCAGTGAAGGAAGTGAGG + Intronic
1158415661 18:57247795-57247817 CTATGGCTGTGAGGGTGTAGAGG - Intergenic
1158694376 18:59690581-59690603 CTTTGTAAGTGAAGCTGGGGTGG - Intronic
1159961286 18:74557535-74557557 CTAGGAGAGTGGGGGTGGGGAGG - Intronic
1160523369 18:79521606-79521628 GTATGTCTGTGTGTGTGGGGGGG + Intronic
1161154156 19:2723496-2723518 CTTTGTGAGTGGGGGTGGGTGGG + Intronic
1161211017 19:3065811-3065833 CCACGGCAGTGGGGGTGGGGTGG - Intergenic
1161726368 19:5931575-5931597 CTATGTGAGTGGGGGTGGGAGGG - Intronic
1162930396 19:13954509-13954531 ATATGTCTGTGGGGGTGGAGGGG - Exonic
1168176997 19:54633479-54633501 CGATGCCACTGAGGGTGGGCAGG - Intronic
1168341229 19:55624289-55624311 CTATGTCATGGTGGGCGGGGTGG - Intronic
925601096 2:5609392-5609414 CTCAGTGAGAGAGGGTGGGGAGG - Intergenic
926841753 2:17088830-17088852 ATTTTTCAGTGAGGGTGGGAGGG + Intergenic
929045465 2:37784794-37784816 CAATGTCCATGAGTGTGGGGAGG - Intergenic
930611662 2:53551225-53551247 CTATTGAAGTGGGGGTGGGGTGG + Intronic
931403127 2:61950269-61950291 ATTTGTCAGTGAGGTTGGGATGG - Intronic
931706903 2:64953916-64953938 GTAAGTCAGTGAGGCTGGCGGGG - Intergenic
931897061 2:66744119-66744141 CTATTTCAGTGACCGTGGGTTGG + Intergenic
932431028 2:71673573-71673595 CTATGACAGCCAGGGTAGGGTGG + Intronic
936142052 2:109948841-109948863 CTCTGCCAGTCAGGGTGAGGTGG + Intergenic
936178742 2:110246801-110246823 CTCTGCCAGTCAGGGTGAGGTGG + Intergenic
936202636 2:110422631-110422653 CTCTGCCAGTCAGGGTGAGGTGG - Intronic
937000467 2:118461392-118461414 CTGGGTGAGTGTGGGTGGGGGGG - Intergenic
937457413 2:122054620-122054642 CTAGGGTAGTGATGGTGGGGTGG - Intergenic
940670710 2:156663938-156663960 CTACGTCAGTGTTGGAGGGGTGG + Intergenic
942451427 2:176110159-176110181 CTATTTCAGTGGGGGCGGGGAGG - Intronic
942922156 2:181388187-181388209 CTATGACCATTAGGGTGGGGTGG - Intergenic
943353339 2:186821314-186821336 GTATGCCATTGGGGGTGGGGAGG + Intergenic
943395182 2:187324551-187324573 CACTTTCAGTAAGGGTGGGGAGG + Intergenic
943629363 2:190233532-190233554 ATATTTCATTGAGGCTGGGGAGG - Intronic
945327747 2:208502136-208502158 CTATGCCAGTAAAGGTGGTGAGG + Intronic
945344541 2:208697425-208697447 CTCTGCCAGTGAGTGTGGGCTGG + Intronic
948587879 2:239031163-239031185 CCATTTCAGTGGGGGTGAGGTGG + Intergenic
1172114056 20:32563249-32563271 GGAGGTCAGGGAGGGTGGGGAGG + Intronic
1172767557 20:37358848-37358870 CTCTGCCAGTGGGGCTGGGGTGG - Intronic
1173182188 20:40813770-40813792 TTATGGCAGAGAGGGTGGGGTGG + Intergenic
1173460061 20:43236024-43236046 GTATGTCACTGAGAGTGGGAAGG + Intergenic
1174417588 20:50377648-50377670 GTGTGTGAGTGAGTGTGGGGAGG + Intergenic
1174467452 20:50729241-50729263 CTGTGTGAGTGAGTGTTGGGTGG - Intergenic
1174583048 20:51586247-51586269 CTATGTCAGGGATGGAGGTGAGG + Intergenic
1174708966 20:52685177-52685199 CTCTGCCATGGAGGGTGGGGTGG - Intergenic
1175758023 20:61542200-61542222 CTCTATCAGTCAGGATGGGGTGG - Intronic
1176041732 20:63069243-63069265 CTGTGTCACTGAGGCTGGAGTGG + Intergenic
1176041930 20:63070259-63070281 CTGTGGGAGGGAGGGTGGGGTGG - Intergenic
1177360982 21:20069766-20069788 CTAAGTCAGTCAGGATGGAGTGG + Intergenic
1178623635 21:34197936-34197958 CTGTGTCAGTGTTGGAGGGGTGG + Intergenic
1181168980 22:20997815-20997837 GGATCTCAGTGAGGGTGGGTGGG - Exonic
1181475299 22:23164370-23164392 CTATGTCAGTCAGGGTGTGTGGG - Intergenic
1181568069 22:23751599-23751621 CTATTTCTGTGGGGGCGGGGAGG - Intergenic
1182351056 22:29700211-29700233 CTATTTTGGTGGGGGTGGGGGGG - Intergenic
1183147405 22:36006677-36006699 GTGAGTCAGTGAGGTTGGGGTGG - Intronic
1183301690 22:37061927-37061949 CTATTTCTGTGGGGATGGGGAGG + Intronic
1183408721 22:37642734-37642756 CCAGGTCAGTGAGGGTGGCCAGG + Intronic
1183619251 22:38963324-38963346 CTCTGTAAGTGAGGGTGGGCGGG - Intronic
1183624400 22:38992919-38992941 CTCTGTGAGTGAGGGTGGGCGGG - Intergenic
1183640151 22:39087936-39087958 CTCTGTGAGTGAGAGTGGGCGGG - Intergenic
1183763768 22:39850806-39850828 GTATGTAAGTGGGGGTGGGCAGG - Intronic
1185414600 22:50703048-50703070 TCAGGTCAGTGAGGGTGGAGTGG + Intergenic
949150845 3:765433-765455 CAATGTCTGGGAGGGTGGGATGG + Intergenic
949831830 3:8223066-8223088 CAATTTCAGGGAGGATGGGGAGG - Intergenic
949876544 3:8629619-8629641 GTGAGTCAGTGAGGGTGTGGTGG - Intronic
949907660 3:8872176-8872198 CTATGTGAATGAGGGTGTGATGG + Intronic
950015864 3:9754567-9754589 CTATCCCATAGAGGGTGGGGAGG + Intronic
950264627 3:11564768-11564790 CTCTGTCTGGGAGGGTGGCGTGG - Intronic
950710444 3:14810048-14810070 CTGATTCAGTGAGGCTGGGGAGG + Intergenic
951263376 3:20539012-20539034 CTATTTCATAGTGGGTGGGGTGG + Intergenic
951285902 3:20813513-20813535 CTATGTCGGTGGGAGTGGGTGGG + Intergenic
954334566 3:49908817-49908839 GTATGTGAGTGAGGGTGGATGGG + Intronic
954444810 3:50540908-50540930 CTGCGTCAGGGAGGGTGGGGTGG - Intergenic
957073864 3:75586055-75586077 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
959438314 3:106345149-106345171 TTATGACAGGGAGGGTGGTGTGG + Intergenic
960083826 3:113569546-113569568 CTATGTCAAGGAGGGTAGAGAGG - Intronic
961001929 3:123379683-123379705 GTGTGTGGGTGAGGGTGGGGAGG + Intronic
961229545 3:125291212-125291234 CTAAGTCAGTGAGGTTGGTATGG - Intronic
961280222 3:125760665-125760687 CTGTGGCAGTGAGGATGGAGAGG - Intergenic
961567466 3:127773950-127773972 CGAAGTCAGGGAGTGTGGGGAGG - Intronic
961817451 3:129558592-129558614 CAAAGACAGTGAGGGTAGGGTGG + Intronic
961874183 3:130008882-130008904 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
961976254 3:131027767-131027789 CTGAGTCTGTGAGGGTGGGCGGG + Intronic
962024193 3:131529690-131529712 CAGTGTCAGGGATGGTGGGGTGG - Intergenic
962365105 3:134773690-134773712 AAATGTCAGAGAAGGTGGGGGGG - Intronic
962411427 3:135144545-135144567 GTATGTGTTTGAGGGTGGGGTGG - Intronic
964656442 3:159072250-159072272 CAATCACAGTTAGGGTGGGGAGG + Intronic
966732006 3:183159222-183159244 CTATGAGAGTGTGGGTAGGGTGG + Intronic
967231118 3:187338356-187338378 GTATGTGTGTGCGGGTGGGGGGG - Intergenic
967294171 3:187949276-187949298 CACTGTCAGTGAGGGTGCTGGGG + Intergenic
968224181 3:196962834-196962856 CTATCTCAGTGAGGGGGATGTGG - Intronic
968819121 4:2836755-2836777 CTGGGTCTGTGAGGGTGGGCTGG + Exonic
969017449 4:4113365-4113387 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
969528771 4:7718030-7718052 CAACGTGTGTGAGGGTGGGGTGG + Exonic
969646303 4:8431464-8431486 CTCTGTGAGTCAGGGTGGTGGGG + Intronic
969736496 4:8994940-8994962 CTGTGGCAGTGAGGATGGAGAGG - Intergenic
969795689 4:9526503-9526525 CTGTGGCAGTGAGGATGGAGAGG - Intergenic
971490709 4:27209489-27209511 CTCTGGAAGTGACGGTGGGGGGG + Intergenic
971679833 4:29683320-29683342 GTCTGTGAGTGAGGGTGGAGGGG + Intergenic
972356118 4:38280782-38280804 CTATGGCGGAGGGGGTGGGGGGG - Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
973919303 4:55668618-55668640 CAAGGTCAGTGATGGTGGGAAGG - Intergenic
975028833 4:69587227-69587249 CCATGTTAGTGAGGGTGAAGTGG + Intergenic
976287750 4:83386426-83386448 CTCTGGCGGTGGGGGTGGGGTGG - Intergenic
977888912 4:102284022-102284044 CTATGTTAGTGTGGGTGGTCAGG - Intronic
978421300 4:108535934-108535956 CTATGTCTGTCAGGGTGCGTAGG - Intergenic
978930630 4:114307230-114307252 AAATGTCAGTGAGGGTGTGGTGG - Intergenic
979311652 4:119210963-119210985 CTAAGACAGTGAGAGTGGAGGGG + Intronic
981454533 4:144938057-144938079 CTCTATCAGTGAGGCTGTGGGGG + Intergenic
981456726 4:144961776-144961798 CCATGTTAATGGGGGTGGGGTGG - Intergenic
981536148 4:145801912-145801934 TCATGGCAGGGAGGGTGGGGAGG + Intronic
982546117 4:156735411-156735433 CTGTGTCAGTTGGGGTGGGGAGG - Intergenic
982933826 4:161444221-161444243 CTGTGTCTGTGAGACTGGGGAGG + Intronic
983784971 4:171718927-171718949 ACATGTCAGTGGGGATGGGGTGG - Intergenic
983999530 4:174224215-174224237 TTATTGCAGTGAGGGTTGGGGGG - Intergenic
984273867 4:177583610-177583632 CTATGTGAGTGAGGGTTTTGTGG + Intergenic
986080323 5:4385189-4385211 GTGTTTCAGTGAGGGGGGGGGGG + Intergenic
986269114 5:6216218-6216240 CTAAGGAAGTGAGGGTGGTGGGG - Intergenic
987082525 5:14438525-14438547 CCATGGCCGTGAGGGTGGGAAGG - Intronic
991908119 5:71532935-71532957 CCAGGCCAGTGAGGGTTGGGAGG - Intronic
992674565 5:79092743-79092765 ATATGTCAATGAGGGTGCAGGGG + Intronic
992776090 5:80090566-80090588 CTATTTCAGTGAGGCTGTGGTGG - Intergenic
993214986 5:85009470-85009492 CTATGTCAGTAAGGTTAGGTAGG - Intergenic
994054593 5:95401063-95401085 CTGTATCAGTGAGGGCAGGGTGG - Intronic
995645477 5:114306449-114306471 CTATGTAATTGGAGGTGGGGTGG + Intergenic
998037019 5:138926069-138926091 CTATGGCCGTGAGGTTGAGGTGG - Intronic
998382999 5:141739151-141739173 CTCTGTCACTCAGGGTGGAGTGG + Intergenic
998496877 5:142598461-142598483 CTATGTAATTTAGGGTGGGAGGG - Intronic
998615270 5:143733673-143733695 CTCTGTCAGTGGGGGAGGGGGGG - Intergenic
998630043 5:143888204-143888226 CCATGACGGTGATGGTGGGGTGG + Intergenic
999538658 5:152547793-152547815 ATATGTCAGTGAGGTAAGGGAGG - Intergenic
1000320936 5:160133792-160133814 GTGTGTCAGGGAGGGTGGGGCGG + Intergenic
1000469569 5:161623594-161623616 CTATGCCAGTGAGTGTGTGGTGG - Intronic
1001228250 5:169963874-169963896 CTAATTCAGTGGGTGTGGGGTGG + Intronic
1003173577 6:3738533-3738555 CTGTGTCACTGGGGGTGGGCTGG - Intronic
1003446858 6:6192820-6192842 GTATGTGAGTGAGTTTGGGGTGG + Intronic
1003869880 6:10393128-10393150 CTCCGTCAGTTGGGGTGGGGAGG + Intergenic
1003875004 6:10427192-10427214 CTGTGTTATTGGGGGTGGGGGGG - Intergenic
1003965913 6:11251926-11251948 CTATGTATGTGTGTGTGGGGGGG + Intronic
1004090939 6:12500594-12500616 CTATGAGAGTGGAGGTGGGGAGG + Intergenic
1004547929 6:16616722-16616744 CTATGTAAGTGTGTGTGGAGGGG - Intronic
1006020597 6:31115474-31115496 CTCTGTAATGGAGGGTGGGGTGG + Exonic
1006389551 6:33750469-33750491 CTGTGTCAGAAAGGGCGGGGAGG - Intergenic
1006403288 6:33830052-33830074 CCAGGGCAGTGAGGGAGGGGAGG - Intergenic
1006520863 6:34570360-34570382 CTATGTGAGTGAGGGAGCGAGGG - Intergenic
1007267864 6:40610827-40610849 AGATGTCATTGAGGTTGGGGTGG - Intergenic
1008842653 6:55922148-55922170 CTATGTGACTGTGAGTGGGGAGG + Intergenic
1014237483 6:118975723-118975745 CTTTGTCACTGAGGCTGGAGTGG - Intronic
1014389843 6:120848056-120848078 CTATGTGATTGGGGGTGGTGGGG + Intergenic
1016540093 6:145154682-145154704 CTGTGTGAGTGAGGGTGGGAGGG + Intergenic
1016767591 6:147812128-147812150 CTATTTCAGAGAGGCTGAGGAGG + Intergenic
1017048990 6:150372752-150372774 GTATGTGTGTGTGGGTGGGGTGG + Intronic
1017667001 6:156729562-156729584 CTGTGTCAGTCTGGGTGTGGTGG + Intergenic
1017963779 6:159246262-159246284 CTGAGTCAGTGAGAGTGGGTGGG + Intronic
1020349981 7:7208820-7208842 CTGTGGGAGTGAGGGTGGGGTGG + Intronic
1021863906 7:24935716-24935738 CTATGTGCCTGGGGGTGGGGTGG + Intronic
1026000151 7:66554694-66554716 CAATGTAGATGAGGGTGGGGAGG + Intergenic
1026032340 7:66805264-66805286 CAATGTAGATGAGGGTGGGGAGG - Exonic
1027269999 7:76513852-76513874 CTAGGCCAGCGTGGGTGGGGAGG + Intronic
1029075940 7:97934195-97934217 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
1029539498 7:101174307-101174329 CTATGTCAGTGAGGGTGGGGTGG - Intronic
1029924305 7:104299537-104299559 CTGTGCCTGTGGGGGTGGGGAGG - Intergenic
1030069860 7:105689247-105689269 CTATGTCACTGGGGCTGGGGTGG + Intronic
1030667121 7:112291305-112291327 CAATTACAGTGAGGGTGGGCAGG + Intronic
1032470741 7:132177231-132177253 GTATGTCAGTGAGGGTGTGTGGG + Intronic
1032685286 7:134226820-134226842 CTATGTCAGTGATGGTAGGCAGG + Intronic
1032724564 7:134578761-134578783 CTATGATACTGAGGGTGGGCAGG - Intronic
1032808797 7:135386744-135386766 GCATGTAAGTGGGGGTGGGGAGG + Intronic
1033079183 7:138279141-138279163 CTCTGTCACTGAGGCTGGAGTGG + Intergenic
1034124651 7:148660506-148660528 CTATTTTAGTGAGGGATGGGGGG - Intergenic
1034923722 7:155104035-155104057 CTATGTCTTCGTGGGTGGGGGGG - Intergenic
1035095975 7:156355907-156355929 CTGTGCCTGTGAGGGCGGGGAGG - Intergenic
1035358322 7:158293145-158293167 GTGCATCAGTGAGGGTGGGGTGG + Intronic
1035888293 8:3316957-3316979 CTGTGTCAGTGGATGTGGGGAGG + Intronic
1036181571 8:6590275-6590297 GGATGTCAGTGAGGATGGAGTGG + Intronic
1036241579 8:7086144-7086166 CTGTGGCAGTGAGGATGGAGAGG - Intergenic
1036260259 8:7233973-7233995 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
1036306358 8:7605550-7605572 CTGTGGCAGTGAGGATGGAGAGG - Intergenic
1036312296 8:7692529-7692551 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
1036357204 8:8053535-8053557 CTGTGGCAGTGAGGATGGAGAGG - Intergenic
1036642805 8:10594560-10594582 CTATCTCTGTGGGGCTGGGGAGG + Intergenic
1036662073 8:10715179-10715201 CTGTGTCAGTGGGGCTTGGGAGG + Intergenic
1036769878 8:11571649-11571671 CTGTGTCTGTGAGCGTGGGGAGG - Intergenic
1036813519 8:11884609-11884631 CTGTGTCAGGGAGGGTGGGGAGG + Intergenic
1036831157 8:12020933-12020955 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
1036901365 8:12671718-12671740 CTGTGGCAGTGAGGATGGAGAGG + Intergenic
1037777129 8:21842902-21842924 TTATCTCATTGAGGGAGGGGAGG - Intergenic
1041210262 8:55543517-55543539 TTGGTTCAGTGAGGGTGGGGTGG - Intergenic
1041576034 8:59396311-59396333 CTATGACACAGAAGGTGGGGAGG - Intergenic
1041737286 8:61124863-61124885 ATGTGCCAGTGAGGGTGGGATGG + Intronic
1041740048 8:61148468-61148490 CTGTATCAATGAGAGTGGGGAGG - Intronic
1042175198 8:66031763-66031785 CACTCACAGTGAGGGTGGGGTGG + Intronic
1042734292 8:71970256-71970278 ATAAGGGAGTGAGGGTGGGGTGG - Intronic
1042796615 8:72670507-72670529 ATATGGCAGTGAGAGTGGAGAGG - Intronic
1042826899 8:72988950-72988972 CTATGTAACTGAGGATGTGGTGG - Intergenic
1043871548 8:85438777-85438799 TTAGGTCAGCGAGGGTGGGGCGG - Intronic
1044238251 8:89856656-89856678 CTATGTCACTGGGGGGTGGGGGG - Intergenic
1045286614 8:100797096-100797118 CCATGTCCCTGAGGGTGTGGTGG - Intergenic
1050689840 9:8214119-8214141 GTATGTGTGTGTGGGTGGGGAGG + Intergenic
1050861960 9:10446122-10446144 CTATTTCAAAGGGGGTGGGGTGG - Intronic
1055758458 9:79580973-79580995 CTATGTGTGTGGGGGTGGGAAGG + Intronic
1056119293 9:83471482-83471504 GCAGGTCAGTGAGGGTGGGTGGG + Intronic
1057276628 9:93679627-93679649 CCCTGGCAGTGAGGGTGGTGGGG + Intergenic
1057277031 9:93681399-93681421 CTATGACAGTGAAGTTGGGAGGG + Intergenic
1057612853 9:96561823-96561845 CTATTACACTGATGGTGGGGTGG + Intronic
1057945299 9:99322545-99322567 CTCTGGGAGAGAGGGTGGGGTGG + Intergenic
1058968407 9:110057965-110057987 CTATCTCAGTGAGGGAGGAAGGG + Intronic
1059666152 9:116448270-116448292 CCATGGCAGTGGGGGTGGGAGGG - Intronic
1059742830 9:117169718-117169740 CTACGTCAGACATGGTGGGGTGG + Intronic
1060966003 9:127712688-127712710 ATCTGTTGGTGAGGGTGGGGTGG - Exonic
1062669682 9:137700654-137700676 CTATGGTAGGGAGGGTGGGGTGG - Intronic
1188328503 X:28837808-28837830 CTATGTGGGTGAGGGAAGGGTGG - Intronic
1189447061 X:41089946-41089968 CTCTGTCACTGAGGCTGGAGTGG + Intronic
1192467865 X:71370351-71370373 CTCTGTCAGGTGGGGTGGGGTGG - Intronic
1192861067 X:75071038-75071060 CTAACTGAGTGGGGGTGGGGAGG + Intronic
1193386287 X:80875490-80875512 TTATGTGAGTGGGGGTGGGGTGG - Intergenic
1194839157 X:98717133-98717155 CTATGTAAGGTAGGGTGTGGGGG + Intergenic
1195510059 X:105705157-105705179 CCATGTCATTTGGGGTGGGGGGG + Intronic
1198080800 X:133237408-133237430 AAATGTCAGTCACGGTGGGGAGG + Intergenic
1199478173 X:148269197-148269219 CTATTGCAGTGTGTGTGGGGAGG + Intergenic
1199845387 X:151689026-151689048 CTGTGTGTGTGTGGGTGGGGGGG - Intergenic
1199965287 X:152814839-152814861 CAAAGTCAGTGGGGGTGGGTTGG - Intergenic