ID: 1029540670

View in Genome Browser
Species Human (GRCh38)
Location 7:101180304-101180326
Sequence GCTGCCGCCGGAGCGTCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029540670_1029540682 17 Left 1029540670 7:101180304-101180326 CCCGGCGACGCTCCGGCGGCAGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1029540682 7:101180344-101180366 CCGGCGACGCGGAAGAAACCCGG 0: 1
1: 0
2: 0
3: 0
4: 29
1029540670_1029540683 18 Left 1029540670 7:101180304-101180326 CCCGGCGACGCTCCGGCGGCAGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1029540683 7:101180345-101180367 CGGCGACGCGGAAGAAACCCGGG 0: 1
1: 0
2: 0
3: 4
4: 35
1029540670_1029540684 22 Left 1029540670 7:101180304-101180326 CCCGGCGACGCTCCGGCGGCAGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1029540684 7:101180349-101180371 GACGCGGAAGAAACCCGGGACGG 0: 1
1: 0
2: 0
3: 3
4: 71
1029540670_1029540677 -2 Left 1029540670 7:101180304-101180326 CCCGGCGACGCTCCGGCGGCAGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1029540677 7:101180325-101180347 GCTTCGAGGGGCGGAGACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 106
1029540670_1029540678 6 Left 1029540670 7:101180304-101180326 CCCGGCGACGCTCCGGCGGCAGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1029540678 7:101180333-101180355 GGGCGGAGACCCCGGCGACGCGG 0: 1
1: 0
2: 0
3: 10
4: 105
1029540670_1029540685 28 Left 1029540670 7:101180304-101180326 CCCGGCGACGCTCCGGCGGCAGC 0: 1
1: 0
2: 1
3: 10
4: 94
Right 1029540685 7:101180355-101180377 GAAGAAACCCGGGACGGATCCGG 0: 1
1: 0
2: 1
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029540670 Original CRISPR GCTGCCGCCGGAGCGTCGCC GGG (reversed) Intergenic