ID: 1029546195

View in Genome Browser
Species Human (GRCh38)
Location 7:101211806-101211828
Sequence TTGGGGTGCCCTCCGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029546177_1029546195 15 Left 1029546177 7:101211768-101211790 CCCGGTGCCCAGGGCAGGAGTGG 0: 1
1: 0
2: 6
3: 61
4: 554
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1029546179_1029546195 14 Left 1029546179 7:101211769-101211791 CCGGTGCCCAGGGCAGGAGTGGG 0: 1
1: 0
2: 7
3: 79
4: 568
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1029546183_1029546195 7 Left 1029546183 7:101211776-101211798 CCAGGGCAGGAGTGGGGTTCCCG 0: 1
1: 0
2: 3
3: 22
4: 230
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1029546174_1029546195 24 Left 1029546174 7:101211759-101211781 CCTGGGGAGCCCGGTGCCCAGGG 0: 1
1: 1
2: 4
3: 49
4: 439
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1029546182_1029546195 8 Left 1029546182 7:101211775-101211797 CCCAGGGCAGGAGTGGGGTTCCC 0: 1
1: 0
2: 2
3: 40
4: 252
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029546195 Original CRISPR TTGGGGTGCCCTCCGGCTGC GGG Intronic
900187684 1:1339959-1339981 TTGGGGTGACGTGCGGCTGCGGG - Intronic
900523130 1:3115769-3115791 TCGGGGTGCCCTCGGGCCGCTGG + Intronic
901663567 1:10813967-10813989 TTGAGGTTTCCTCCGGCGGCTGG - Intergenic
906531571 1:46526752-46526774 CCTGGGTGCCCTCCCGCTGCAGG - Intergenic
908041723 1:60120916-60120938 TTCAGGGGCCCTCAGGCTGCTGG - Intergenic
912708168 1:111930268-111930290 TTGGGGTTCCCTCCAGCCCCAGG - Intronic
914380025 1:147107376-147107398 ATGGGGTGCCTTCCAGCTTCTGG + Intergenic
916743277 1:167664419-167664441 TTGAGGTGCACTCAGGCTGCAGG - Intronic
916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG + Intronic
919755995 1:201066584-201066606 TTGGGGTGCTCACCGTCTGACGG - Intronic
921324082 1:213973464-213973486 CTGGGGTGGCCTCTTGCTGCTGG - Intergenic
922554705 1:226523845-226523867 CTGGGGTGGCCTGCGGATGCAGG + Intergenic
922832756 1:228611886-228611908 TTGCGGTGCCTTCCCGCTCCCGG - Intergenic
922959586 1:229635162-229635184 TTGGGTTGACCTGCTGCTGCAGG - Exonic
1063449963 10:6144769-6144791 TCCGGGCGCCCTCGGGCTGCTGG - Intergenic
1064167710 10:13001277-13001299 TGGAGGTGCCCGCCGGCTCCAGG - Exonic
1072808954 10:98445139-98445161 TGGGGGTGGCCTCAGGATGCAGG + Intronic
1076468457 10:130702118-130702140 TTGGGGTATCCTCCCCCTGCAGG + Intergenic
1076535628 10:131174939-131174961 TTGGGGTGGGTTCAGGCTGCAGG - Intronic
1076939293 10:133590858-133590880 TGGGGGTGTCCTCCTGCAGCCGG - Intergenic
1081666493 11:44919908-44919930 TTGGGGTTCCCTCCGGCAGCAGG - Exonic
1082654689 11:55839442-55839464 TTGCGGTGCCCACTGGCTGAAGG - Exonic
1084173189 11:67410309-67410331 CTGGGGCGCCCTCCTCCTGCAGG - Intronic
1084649040 11:70477622-70477644 TTGGGGTGCCCTCCCCCACCAGG - Intronic
1093192901 12:16095439-16095461 TTGGGGTGCTCTCCAGGTTCAGG - Intergenic
1094831086 12:34300612-34300634 TTGGGGTGTCCCCCGCGTGCAGG - Intergenic
1097191483 12:57221512-57221534 TTGAGGTGGCCTCCTGCTGCTGG - Intronic
1101199483 12:102419647-102419669 CTGAGGCGCCCTCCGACTGCTGG + Exonic
1101874399 12:108589232-108589254 CTGGGGCCCCCTCCGGCTGGAGG + Intergenic
1103553795 12:121753909-121753931 TGGGGGTGCTCCCCAGCTGCTGG + Intronic
1103954170 12:124567339-124567361 TTGGGGCGCGCTCGGGCCGCCGG + Intronic
1106055342 13:26231825-26231847 TTGGGCTGTCCTGCAGCTGCAGG + Intergenic
1111699975 13:91674900-91674922 TTTGGGTGGCCTCTGCCTGCTGG - Intronic
1114469513 14:22949776-22949798 TGGGAGTGTCCTCCTGCTGCAGG - Intronic
1114549507 14:23524923-23524945 CTGGGGGAGCCTCCGGCTGCAGG - Exonic
1124192187 15:27589453-27589475 CTGGGGTGGCCTCCTGCGGCCGG + Intergenic
1127551656 15:60044413-60044435 TTCTGCTGCCCTCCAGCTGCTGG - Intronic
1132020170 15:98354165-98354187 TGGGGGTGCACACCTGCTGCTGG - Intergenic
1132865356 16:2090422-2090444 GTGGGGCGCCCTACGGCTGGGGG - Exonic
1133823129 16:9254481-9254503 TTGAGGTGCCCTCTGGCTACTGG + Intergenic
1137584049 16:49653370-49653392 TTGCTGTTCCCTCCGGCGGCTGG - Intronic
1137607495 16:49796386-49796408 TTGGGGAGCCCTCTGGGTGGAGG - Intronic
1137811720 16:51359128-51359150 CTGGGCTGGCCTCCTGCTGCTGG + Intergenic
1138506158 16:57479330-57479352 CGCGGCTGCCCTCCGGCTGCCGG - Intronic
1139470134 16:67174017-67174039 TTGCGGAGCCGTCCGGCGGCTGG + Exonic
1141687252 16:85577443-85577465 TTTGGATGTCCTCCAGCTGCTGG - Intergenic
1142005462 16:87687720-87687742 TGAGGGTGCCCTCCTGCTGGTGG + Intronic
1142866463 17:2794483-2794505 CTGGGGTGGCTTCAGGCTGCTGG - Intronic
1143260290 17:5593516-5593538 CTAGGGAGCTCTCCGGCTGCAGG + Intronic
1143608453 17:8003810-8003832 TCGCGGCGCCGTCCGGCTGCCGG - Intronic
1143781607 17:9232251-9232273 CTGGGGTGCCCTCGGGATGCAGG - Intronic
1144420841 17:15097139-15097161 TTGAGGTGCAGTCTGGCTGCAGG - Intergenic
1144515997 17:15917844-15917866 TTGGGGTGGCCTCCTGTGGCAGG - Intergenic
1146937616 17:36822113-36822135 CTGGGGTGCCCCAGGGCTGCTGG - Intergenic
1147928695 17:43962577-43962599 CAGGGGTGCCCTCAGACTGCCGG + Intronic
1148198038 17:45728847-45728869 CTGGGGTGCCCTCTGGTTGTTGG + Intergenic
1150275785 17:63896835-63896857 GGTGGGTGCCCTCTGGCTGCAGG + Intergenic
1153975337 18:10263847-10263869 TTGGGGTGCACTCCCACTTCCGG - Intergenic
1154466236 18:14644195-14644217 TGGAGGTGCCCTCCTCCTGCTGG + Intergenic
1160044637 18:75375495-75375517 CTTGGGTGTCCTCTGGCTGCGGG + Intergenic
1160893793 19:1393423-1393445 TGGGGGAGCCCGCCGTCTGCTGG - Intronic
1160960964 19:1720622-1720644 TGGGGGTGCCTTCTGGCTGGGGG + Intergenic
1161321034 19:3641659-3641681 TCGGGGCGCCCACCTGCTGCGGG - Intronic
1163369103 19:16892214-16892236 ATGGGGTGCCCTCAGCCTCCTGG - Exonic
1167570053 19:50281332-50281354 CTGGGGAGCCCCTCGGCTGCTGG - Intronic
1167649384 19:50721143-50721165 CTGGGTTCCCCTCCAGCTGCAGG + Intergenic
925161128 2:1685197-1685219 TTTGGGGGCCCTCCGGCTGCAGG - Intronic
925376175 2:3387926-3387948 TCGGGGTGCCCGCGGGCTCCGGG - Exonic
928085154 2:28341440-28341462 TTGGGCTGCCCTCTGTGTGCAGG - Intergenic
928464779 2:31513648-31513670 TTGGGGTGCCCTCTGGTAGTAGG - Intergenic
929654089 2:43712338-43712360 TGGGTTTGCCCTCAGGCTGCAGG - Exonic
929948159 2:46386040-46386062 TTGCGGGGCCATCTGGCTGCCGG - Exonic
930030521 2:47055772-47055794 CTGGGGTGGCCTCCAACTGCGGG - Intronic
931365973 2:61619393-61619415 TTGGAATGCACTCCGGGTGCAGG - Intergenic
931872928 2:66481114-66481136 CCTGGGTGCCCTCCTGCTGCAGG - Intronic
932421608 2:71604551-71604573 TTGGGGAGCTGTCTGGCTGCAGG + Intronic
934571311 2:95374826-95374848 AGGGGGTGCCTTCCTGCTGCAGG + Exonic
935732284 2:106074045-106074067 TAGGTGTTGCCTCCGGCTGCAGG + Intronic
936158864 2:110069211-110069233 TTGGGGAGCCCTCCTGCCTCTGG - Intergenic
936185796 2:110302121-110302143 TTGGGGAGCCCTCCTGCCTCTGG + Intergenic
936257240 2:110927371-110927393 CTGGGGTGCCTTCCACCTGCTGG + Intronic
937230013 2:120392549-120392571 TAGGGGTGCCCTCCTGCAGGAGG + Intergenic
947717550 2:232349506-232349528 TGGGGGTGGCTTCTGGCTGCAGG + Intergenic
948051442 2:234982319-234982341 TGTTGGTGCCCTCCGCCTGCTGG + Intronic
948750702 2:240131032-240131054 GTGAGATGCCCTCTGGCTGCAGG - Intronic
948853769 2:240720778-240720800 TTGGGGTGGCCACAGGCTGAGGG - Intronic
1175304402 20:57965955-57965977 CTGGGGTGCCCCCTGACTGCAGG + Intergenic
1175715683 20:61252997-61253019 GTGGGGCGCCCGGCGGCTGCGGG + Intronic
1176808352 21:13514401-13514423 TGGAGGTGCCCTCCTCCTGCTGG - Intergenic
1180907798 22:19427364-19427386 CTGCAGTGCCCTCCGGCAGCAGG + Intronic
1182349607 22:29691957-29691979 TGGGGGTGGCCTCCAGCAGCAGG + Intronic
1182464326 22:30505254-30505276 TGGCGCTGCCATCCGGCTGCGGG - Intronic
1184251476 22:43262760-43262782 GTGGGGTGGCCTGCGACTGCAGG - Exonic
1184291669 22:43500741-43500763 TTGGAGGGCCCCCAGGCTGCAGG + Intronic
1184390881 22:44202403-44202425 CTGGGGTGCCCCTGGGCTGCAGG + Intronic
1184751884 22:46491017-46491039 TTGGGGGGCCCTCCATTTGCAGG - Intronic
961221561 3:125205083-125205105 TAGGGGTGGCCTCTGGTTGCCGG - Intronic
961519021 3:127456232-127456254 GGAGGGTGCCCGCCGGCTGCTGG - Intergenic
961654932 3:128435938-128435960 GTGGGGTGCCCTCTGCCTGGTGG + Intergenic
961760391 3:129162869-129162891 TTGGGGAGCCCTCTGGTTGTGGG + Intergenic
968831268 4:2934014-2934036 TTAGGGTGCTCGCCGGCTGTCGG - Exonic
982099865 4:151957440-151957462 GTGGGGTGGCCTCCTGCTGGTGG + Intergenic
985085949 4:186312494-186312516 TTGGAGATCCCTCCGGCAGCAGG - Intergenic
985718701 5:1477141-1477163 CTGGGGTGACCAACGGCTGCAGG + Intronic
985733474 5:1564347-1564369 TTGCGGTGACCGCCTGCTGCCGG + Intergenic
985835754 5:2270731-2270753 CTGGGGTGCCCTGCGGTCGCAGG + Intergenic
986798354 5:11234065-11234087 TTGGGGTGGCCCCCAGCAGCTGG - Intronic
986988507 5:13525365-13525387 TTGGGGTTCCATCAGGCTGGTGG - Intergenic
987373749 5:17216858-17216880 TTGGGGTGAGCCCCAGCTGCAGG - Intronic
987736164 5:21846301-21846323 TTCGGGTGCCCTCTCTCTGCAGG + Intronic
989537033 5:42575655-42575677 GTCGGCTGCCCTCAGGCTGCTGG - Intronic
989643275 5:43603460-43603482 TTGGGGTGTCCGCAGGCCGCAGG + Intronic
997239348 5:132295138-132295160 TTGGGGTGCACACCCGCTGCTGG - Intronic
1001209155 5:169794091-169794113 CAGGGCTGCCCTCGGGCTGCAGG + Intronic
1001634973 5:173203268-173203290 TAGGGTAGCCCTCGGGCTGCAGG - Intergenic
1007105852 6:39282404-39282426 AGGGGGTGCTCTCTGGCTGCAGG + Intergenic
1007665979 6:43513185-43513207 TCAGGGTGCCCTCCCGCTGTGGG + Exonic
1007816649 6:44529735-44529757 TTGTGGAGCCCTCCAGATGCTGG + Intergenic
1013760388 6:113511093-113511115 TTGGGGTTTCCTCCAGCTGGTGG - Intergenic
1019497161 7:1346028-1346050 TGGGGCTGCCCGCCGGCCGCAGG - Intergenic
1020418226 7:7969495-7969517 GTGGGCTGCGCCCCGGCTGCGGG + Exonic
1028307987 7:89290462-89290484 TTGGGCTGCTCTCTGGCTCCAGG - Intronic
1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG + Intronic
1034250208 7:149684360-149684382 TTGGGTTGCCCACCAGCTTCAGG - Intergenic
1042359546 8:67867332-67867354 TTGGGATGCCATCAGGCTGAGGG + Intergenic
1048873068 8:138814668-138814690 CTGGGCTGCCCTCAAGCTGCTGG - Intronic
1049421181 8:142517350-142517372 CTGGGGTGTCATCCGGGTGCCGG - Intronic
1061917295 9:133761977-133761999 TTGGGGTTCCCGCCAGCTGGGGG + Exonic
1062510422 9:136902313-136902335 TTGGGGTACCAGCTGGCTGCAGG + Intronic
1187206156 X:17183694-17183716 TTAGAGTTCCCTCTGGCTGCAGG - Intergenic
1187701479 X:21968015-21968037 TTGGGGTGCCCACCACCTGTGGG + Intronic
1197726115 X:129777584-129777606 TGGGGCTGCCCTCCTGCTCCTGG + Intergenic
1198956444 X:142136639-142136661 TTGGGCTCCCCTACGGCTGACGG - Intergenic
1200244788 X:154517187-154517209 CTGGGGTGGTCTCCGGCCGCAGG + Intergenic