ID: 1029546195

View in Genome Browser
Species Human (GRCh38)
Location 7:101211806-101211828
Sequence TTGGGGTGCCCTCCGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029546182_1029546195 8 Left 1029546182 7:101211775-101211797 CCCAGGGCAGGAGTGGGGTTCCC 0: 1
1: 0
2: 2
3: 40
4: 252
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1029546183_1029546195 7 Left 1029546183 7:101211776-101211798 CCAGGGCAGGAGTGGGGTTCCCG 0: 1
1: 0
2: 3
3: 22
4: 230
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1029546179_1029546195 14 Left 1029546179 7:101211769-101211791 CCGGTGCCCAGGGCAGGAGTGGG 0: 1
1: 0
2: 7
3: 79
4: 568
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1029546174_1029546195 24 Left 1029546174 7:101211759-101211781 CCTGGGGAGCCCGGTGCCCAGGG 0: 1
1: 1
2: 4
3: 49
4: 439
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124
1029546177_1029546195 15 Left 1029546177 7:101211768-101211790 CCCGGTGCCCAGGGCAGGAGTGG 0: 1
1: 0
2: 6
3: 61
4: 554
Right 1029546195 7:101211806-101211828 TTGGGGTGCCCTCCGGCTGCGGG 0: 1
1: 0
2: 2
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029546195 Original CRISPR TTGGGGTGCCCTCCGGCTGC GGG Intronic