ID: 1029546447

View in Genome Browser
Species Human (GRCh38)
Location 7:101212781-101212803
Sequence CGTGCTGAGCAGGAGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029546447_1029546450 1 Left 1029546447 7:101212781-101212803 CCTTGTACCTCCTGCTCAGCACG 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1029546450 7:101212805-101212827 TGCCCTCTCGTGCCCCTCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 333
1029546447_1029546462 28 Left 1029546447 7:101212781-101212803 CCTTGTACCTCCTGCTCAGCACG 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1029546462 7:101212832-101212854 CCCACCTCACCTGCCCCCCCGGG 0: 1
1: 0
2: 8
3: 70
4: 712
1029546447_1029546460 27 Left 1029546447 7:101212781-101212803 CCTTGTACCTCCTGCTCAGCACG 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1029546460 7:101212831-101212853 CCCCACCTCACCTGCCCCCCCGG 0: 1
1: 2
2: 12
3: 96
4: 763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029546447 Original CRISPR CGTGCTGAGCAGGAGGTACA AGG (reversed) Intronic
900898614 1:5501854-5501876 CTTCCTGAGCAGGCTGTACATGG + Intergenic
900960903 1:5919339-5919361 AGTACTGAGCAGAAGGTACAGGG + Intronic
901458245 1:9376280-9376302 CGGGCTGAGCAGGAGGGATCAGG - Intergenic
901749258 1:11395948-11395970 GGTGCTGGTCAGGAGGTCCAGGG + Intergenic
906126145 1:43428115-43428137 CGTGGTGAGCAGGAGGGCCGTGG + Exonic
907286045 1:53380391-53380413 GGTGCTGAACAGGAGGAACAAGG + Intergenic
907879735 1:58536297-58536319 TGTGCTGAGCAGGAGTTAGCTGG + Intronic
913320980 1:117588235-117588257 AGTGTTGAGCAGGAGGTGGATGG - Intergenic
915001658 1:152599963-152599985 AGAGGTGGGCAGGAGGTACAGGG + Intronic
915267795 1:154731434-154731456 CCTGCTGAGCAGGAGGGGCCAGG - Intronic
918557629 1:185822298-185822320 CGGGGTGGGCAGGAGGTACATGG + Intronic
920268133 1:204742267-204742289 TGTACCGAGCAGGAGGTATAGGG + Intergenic
921006593 1:211099970-211099992 CTTAGTGAGCAGGAGGTAGAGGG - Intronic
924884809 1:248203240-248203262 TTGGCTGAGGAGGAGGTACATGG - Exonic
924904825 1:248441352-248441374 CTGGCTGAGCAGGAAGTACATGG - Exonic
924905965 1:248452973-248452995 CTGGCTGAGCAAGAAGTACATGG - Exonic
924921924 1:248639061-248639083 CTGGCTGAGCAAGAAGTACATGG + Exonic
924923062 1:248650690-248650712 CTGGCTGAGCAGGAAGTACATGG + Exonic
1062967743 10:1623048-1623070 TGTGCTGAGCAGGAGTTGGAAGG + Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1073305221 10:102497943-102497965 AAGGCTGAGCAGGTGGTACACGG + Intronic
1075197031 10:120368781-120368803 CCTGGGGAGCAGGTGGTACAGGG - Intergenic
1076494052 10:130885286-130885308 AGTGCTGAGCAGGGGTTCCAGGG + Intergenic
1077117828 11:893321-893343 GGTGCTGAGCAGGAGGGCCTGGG + Intronic
1077374721 11:2200095-2200117 TGTGCTGAGCAGGACAGACAGGG + Intergenic
1077693193 11:4368095-4368117 CATGCAGAGGAAGAGGTACATGG + Exonic
1079181415 11:18196998-18197020 CGTGGTCAGCAGGATGTGCAGGG - Intronic
1079293090 11:19206433-19206455 TGAGCTGAGCAGAATGTACATGG - Intronic
1080547465 11:33335030-33335052 CATGATGAGGAAGAGGTACAGGG + Intronic
1083020642 11:59503748-59503770 ATTGCGGAGCAGGAAGTACATGG - Exonic
1083021762 11:59515085-59515107 GTTGCGGAGCAGGAAGTACATGG - Exonic
1085017104 11:73181277-73181299 CATGCTGAGCTGGAGGTGCACGG + Intergenic
1086575089 11:88330671-88330693 TGAGTTGAGCAGGAGGTACTAGG - Intronic
1092901172 12:13060670-13060692 CGTGCTGAGGAATAGGTAGAAGG + Intronic
1093400301 12:18738280-18738302 CGTGCTGAGCAGGAAGGACAAGG + Exonic
1095539209 12:43288834-43288856 CATGCTGAGAAGGAAGTTCAGGG + Intergenic
1097199936 12:57269790-57269812 CTTGCTGAGTAGGTGGTGCATGG + Exonic
1103626678 12:122225636-122225658 CGTGGAGAGGAGGAGGGACACGG - Intronic
1106289127 13:28344246-28344268 CGTGGAGAACAGGAGGAACAAGG - Intronic
1106482408 13:30146856-30146878 CCAGCTGAGCAGGAAATACACGG + Intergenic
1107823125 13:44304205-44304227 GCTGCAGAGCAGAAGGTACACGG + Intergenic
1108455114 13:50605395-50605417 CATGCTAAACAGCAGGTACAAGG - Intronic
1113537618 13:111080816-111080838 CTTGCAGGGCAGGAGGAACAAGG - Intergenic
1114135733 14:19847539-19847561 GTTGCTGAGCAGGAAGTACATGG - Intergenic
1120079128 14:80195718-80195740 TGTGTGGAGCAGGAGGTATATGG + Intergenic
1120252470 14:82075746-82075768 GGTGCTGAGCAGGAGGTAAATGG - Intergenic
1123033331 14:105461421-105461443 GGTCCTGAGGTGGAGGTACAGGG - Intronic
1123753538 15:23378341-23378363 CGTACTGAGCAGGATTTAGAGGG + Intergenic
1124007464 15:25806203-25806225 CGTGCTGAGGAGGAAGTGGAGGG - Intronic
1128037627 15:64540629-64540651 CGTGCGGATCACGAGGTAAAGGG - Intronic
1128043634 15:64597407-64597429 TGTGCTGAGAAGGAGGGAGAAGG - Intronic
1129136334 15:73555513-73555535 TATGCTAAGCAGGAAGTACAGGG - Intronic
1129237605 15:74233123-74233145 CGTTCAGAGCAGGAGATAAAGGG - Intergenic
1129652479 15:77500936-77500958 CTTGCAGAGCAGGAAGGACAAGG - Intergenic
1129710935 15:77819923-77819945 CGGGCTGGGCAGGTGGGACAAGG - Intronic
1131465939 15:92655176-92655198 CGGGCAGGGCAGGAGGCACACGG + Intronic
1131785259 15:95905399-95905421 CATGCTGAACAGGAAGTCCATGG - Intergenic
1133237755 16:4395491-4395513 TGTGCTGAGGAGGAGGAACAGGG - Intronic
1134095799 16:11417631-11417653 AGTGCTGAGCTGCAGATACACGG - Exonic
1134462839 16:14444670-14444692 CGTACTGAGCAGGATTTAGAGGG - Intronic
1135654480 16:24235801-24235823 GGTGCTGAGTAGGGGGGACATGG - Intergenic
1135830610 16:25769556-25769578 TGTGCTCAGCAGGTGGTACCAGG + Intronic
1136296611 16:29307645-29307667 TGTGCTGAGCAGGAAGCACAGGG + Intergenic
1137345390 16:47653278-47653300 AGTGGAGAGCAGGAGATACAAGG - Intronic
1137628354 16:49923653-49923675 CGTGCTGAGCAGCACCTACCTGG - Intergenic
1138129220 16:54465256-54465278 CGGGCTGAGCAGCAGCTAAAGGG + Intergenic
1138243018 16:55444482-55444504 CCTCCTGAGCAGGAGGTGCTGGG + Intronic
1139700972 16:68707803-68707825 CTTGCTGGGCAGTGGGTACAGGG - Intronic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1142058234 16:88013956-88013978 TGTGCTGAGCAGGAAGCGCAGGG + Intronic
1146667551 17:34715204-34715226 GGGGCTGAGCAGGAGGGAAAGGG - Intergenic
1148964293 17:51421718-51421740 AGGGCTGAGCAGGTGGGACAGGG + Intergenic
1151441247 17:74130583-74130605 CGTGCAGAGCAGGAGCTGGACGG + Intergenic
1152190344 17:78884126-78884148 CGTGCAGGGCAGGAGGCAGAGGG + Intronic
1153512246 18:5868790-5868812 AGTACGGAGCAGGAGGCACATGG - Intergenic
1153805752 18:8706811-8706833 CGTGGAGAGCAGGAGGGAGAAGG - Intronic
1156401777 18:36745821-36745843 GGGGATGAGCGGGAGGTACACGG - Intronic
1156475723 18:37404231-37404253 TGAGCTGAGCAGGAGCTTCAGGG - Intronic
1157195800 18:45619305-45619327 TGTCCTGAGCAGGAGGCACAAGG - Intronic
1157283175 18:46359391-46359413 CCTCCTGAGCAGGTGGCACATGG + Intronic
1157339677 18:46768231-46768253 CATGCTGAGCAGCAGGCACTCGG - Intergenic
1157442943 18:47724274-47724296 CGTGGGGAGCAGGGGCTACATGG - Intergenic
1159748560 18:72271042-72271064 CTTGGTGAGCAGGAGGTATATGG - Intergenic
1161611856 19:5247711-5247733 GATGCTGAGGAGGAGGTTCAAGG + Intronic
1161706035 19:5822247-5822269 CGTGCAAGGCTGGAGGTACAAGG + Intergenic
1162162786 19:8731201-8731223 CTGGCTGAGCAGGAAGTACATGG - Exonic
1163053386 19:14701562-14701584 CCTGCTGAGCAAGAGAGACATGG - Intronic
1167634456 19:50646373-50646395 CGTGAAGACCAGGAGGGACAGGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
928115597 2:28543337-28543359 CGTGCTGAGGAGGGGCTGCAGGG + Intronic
930248124 2:49005570-49005592 AGTGCTTAGGAGGAGGTACTGGG + Intronic
930983670 2:57558969-57558991 AATGCTGCGAAGGAGGTACAAGG + Intergenic
934559633 2:95306509-95306531 AGTGCTGAGATGGAGGTGCATGG + Intronic
936003992 2:108865799-108865821 CGTGATGAGCCAGAGGTAGAGGG + Intronic
945069373 2:205975639-205975661 CATGCTAAGCAGCACGTACAAGG - Intergenic
945443964 2:209913893-209913915 CATGCTGAGCAGGAGCTCCCAGG - Exonic
946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG + Intergenic
948414433 2:237792027-237792049 AGTGCTGAGCAAGAGAGACATGG - Intronic
948438332 2:237968376-237968398 TGTGCCGAGCAGGAGGTTCCTGG + Intronic
1169607424 20:7338261-7338283 TGTGCTGACCAGGTGGTGCATGG + Intergenic
1171280186 20:23889806-23889828 TGAACTGAGCAGGAGTTACAGGG - Intergenic
1174287230 20:49482316-49482338 CGTGCGGGGCAGGCGGTCCAGGG + Exonic
1177220946 21:18192107-18192129 TGTGTTGAGAAGGAGGGACAGGG - Intronic
1178286519 21:31329939-31329961 CGTGTGGGGCAGGAGGTATATGG - Intronic
1178354538 21:31899686-31899708 GGTGCTGAGCAGGAGTAGCAGGG - Intronic
1180728034 22:17960889-17960911 CGAGCTCAGCAGGAGGTGCTGGG + Intronic
1181977956 22:26745336-26745358 CCCACTGAGCAGGAAGTACATGG - Intergenic
1182803584 22:33051965-33051987 TGTGCTCACCAGGAGCTACAAGG - Intronic
1183751545 22:39723767-39723789 CCAGCTGAGCAGGAGGAAGACGG + Intergenic
1183936564 22:41265750-41265772 GGGGCTGAGCAGGTGGTCCATGG + Intronic
1184010332 22:41743173-41743195 CTTGCTGAGCAGGAGGCCCCTGG + Exonic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184496014 22:44841940-44841962 GGTGCTGATCAGGAGCCACACGG - Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
952737564 3:36705525-36705547 AGTGCTGAGCTGGAGCTACTGGG + Intergenic
953473871 3:43189622-43189644 CAACTTGAGCAGGAGGTACAAGG + Intergenic
954404701 3:50338923-50338945 GGAGCTGAGCAGGAGCTGCAGGG - Intronic
961448768 3:126993053-126993075 AGTGCTGGGCAGCAGGAACAGGG - Intronic
962108041 3:132414155-132414177 TGTGGGGAGCAGGGGGTACAGGG + Intergenic
963081157 3:141394775-141394797 AGAGCTTAGCAGGAAGTACAGGG - Intronic
965470614 3:169085734-169085756 TCTGCTGAGCAGAAGGTGCATGG + Intronic
968007709 3:195254459-195254481 CGTGCTGAGCAAGAGTGAGAGGG - Intronic
968771548 4:2510755-2510777 CGTGCTCAGCAAGAGGGAAAGGG + Intronic
973794755 4:54413255-54413277 TGTACTTAGCAGGAGGAACAGGG + Intergenic
986434721 5:7717867-7717889 CATGCAGAGCAGAAGGCACATGG + Intronic
986739074 5:10689855-10689877 CGAGCTGAGGAGCAGGGACAGGG + Intronic
995850239 5:116537393-116537415 CGTGCAGAGCAGGAAGCACCAGG - Intronic
999968538 5:156835587-156835609 GGTGCTGGGCAGGTGGTTCACGG - Intergenic
1001539382 5:172526663-172526685 CCTGCTGAGCACAAGGAACAGGG - Intergenic
1002369234 5:178737607-178737629 CTTGCTGTGCAGGAGGTTTAAGG - Intergenic
1003194567 6:3903319-3903341 CTTCCTGAGCAGGTAGTACAAGG + Intergenic
1003756778 6:9130217-9130239 TATGCTGAACAGGAGGTTCAAGG - Intergenic
1005743822 6:28817412-28817434 TGTTCTGAGCAGGAGATACTTGG + Intergenic
1007158150 6:39766287-39766309 CATGCGCAGCAGGAGGTTCATGG - Intergenic
1007345142 6:41223472-41223494 TGTGAGGAGCAGGAGGTATACGG - Intergenic
1012815682 6:104019047-104019069 CTTGCTGAGTAGGTGGTGCATGG + Intergenic
1013312980 6:108914926-108914948 CCTGCTGAGCTGGAGTTACCAGG - Intronic
1015519157 6:134114255-134114277 TGTGCAGAGCAGGAGGCAGAGGG + Intergenic
1017796397 6:157848698-157848720 TGTGCTGAGCAGGACTGACAGGG + Intronic
1017939132 6:159036096-159036118 CGTGGTGAGCAGGTGGAAGAGGG + Exonic
1023577939 7:41649457-41649479 CTTGCTGACCATGACGTACATGG + Intergenic
1024358651 7:48444770-48444792 CGTGTTGAGATGGAGGTACCTGG - Intronic
1027559414 7:79708470-79708492 CTTGCTGAGTAGTAGGGACAGGG - Intergenic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1028470242 7:91197983-91198005 CGTGTTGTGAAGCAGGTACATGG + Intronic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1029546447 7:101212781-101212803 CGTGCTGAGCAGGAGGTACAAGG - Intronic
1036210071 8:6834572-6834594 CGCGCCGAGCAGGACGCACACGG - Intronic
1037414280 8:18632282-18632304 AGGGTTGAGCAGGAGGGACAAGG - Intronic
1037961830 8:23103345-23103367 CGGGCTGGGCAGGAGGGACCCGG + Intronic
1039723305 8:40188028-40188050 AGTGCTGAGCAGAATGGACATGG + Intergenic
1039781774 8:40793182-40793204 CGTGGTGAGAGGGGGGTACATGG + Intronic
1041179880 8:55236348-55236370 CATGCAGACCAGGAGGTACAAGG - Intronic
1041219359 8:55633515-55633537 AGTGCTGAGCAGGAAAGACAAGG - Intergenic
1042474487 8:69231720-69231742 TGTGTGGAGCAGGAGGTATATGG + Intergenic
1044628230 8:94255412-94255434 CGTGCTGAGCAGGGAGGAGATGG - Intronic
1045747622 8:105441780-105441802 CCTGGTGAGCAGGAGGTTTATGG - Intronic
1048154975 8:131938159-131938181 CTTGCTGAACAGTAGGTAAAAGG + Intronic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1050506910 9:6358096-6358118 AGAGCTGGGCAGGAGGTAGAAGG - Intergenic
1056531513 9:87492410-87492432 CATGCTGAGCATGATGGACAAGG + Intergenic
1059331836 9:113540539-113540561 GGTACTGAGCAGGAGGCTCACGG - Intronic
1060654546 9:125360764-125360786 CATTCTGAGCAGGTGGCACAGGG + Intronic
1061093003 9:128437186-128437208 GGTGCTGAGGTGGAGGTAGAAGG - Exonic
1061162861 9:128905615-128905637 CGGGCAGATCAGGAGGTAAAGGG + Intronic
1062395106 9:136349655-136349677 CGTGAGGAGCAGGAAGTACCAGG + Exonic
1191697364 X:64003806-64003828 GGTGATGGGCAGAAGGTACAAGG - Intergenic
1192047558 X:67692169-67692191 CCTGCTGAACAGGAAGTAGAGGG - Intronic
1192632473 X:72788070-72788092 CCTGCTGAGCAGGAGGCTCTGGG + Intronic
1192649236 X:72932731-72932753 CCTGCTGAGCAGGAGGCTCTGGG - Intronic
1193235143 X:79097465-79097487 AGTGGTGAGCAAGAGGGACATGG - Intergenic
1195412932 X:104588309-104588331 CTTTCTGAGCAGCATGTACAAGG + Intronic
1196072617 X:111543252-111543274 CGGGCTGAGCAAGGGGTTCAAGG + Intergenic
1196411630 X:115425782-115425804 TGTGGTGGGCAGGAGGTATATGG - Intergenic