ID: 1029546645

View in Genome Browser
Species Human (GRCh38)
Location 7:101213726-101213748
Sequence CTCACTCCCAACACGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029546642_1029546645 28 Left 1029546642 7:101213675-101213697 CCTGGCTAATTTTTGTATTTGTA 0: 676
1: 75715
2: 133345
3: 97921
4: 67181
Right 1029546645 7:101213726-101213748 CTCACTCCCAACACGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029546645 Original CRISPR CTCACTCCCAACACGCAGGC TGG Intronic
No off target data available for this crispr