ID: 1029547349

View in Genome Browser
Species Human (GRCh38)
Location 7:101217325-101217347
Sequence CGCCTGGATCCCAGCTCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029547340_1029547349 13 Left 1029547340 7:101217289-101217311 CCAGACAGCACCCAGGATCCTGG 0: 1
1: 0
2: 0
3: 22
4: 259
Right 1029547349 7:101217325-101217347 CGCCTGGATCCCAGCTCCGGAGG 0: 1
1: 0
2: 1
3: 22
4: 274
1029547339_1029547349 14 Left 1029547339 7:101217288-101217310 CCCAGACAGCACCCAGGATCCTG 0: 1
1: 0
2: 2
3: 37
4: 229
Right 1029547349 7:101217325-101217347 CGCCTGGATCCCAGCTCCGGAGG 0: 1
1: 0
2: 1
3: 22
4: 274
1029547345_1029547349 -5 Left 1029547345 7:101217307-101217329 CCTGGGATCTCCGCTACGCGCCT 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1029547349 7:101217325-101217347 CGCCTGGATCCCAGCTCCGGAGG 0: 1
1: 0
2: 1
3: 22
4: 274
1029547343_1029547349 3 Left 1029547343 7:101217299-101217321 CCCAGGATCCTGGGATCTCCGCT 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1029547349 7:101217325-101217347 CGCCTGGATCCCAGCTCCGGAGG 0: 1
1: 0
2: 1
3: 22
4: 274
1029547344_1029547349 2 Left 1029547344 7:101217300-101217322 CCAGGATCCTGGGATCTCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1029547349 7:101217325-101217347 CGCCTGGATCCCAGCTCCGGAGG 0: 1
1: 0
2: 1
3: 22
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029547349 Original CRISPR CGCCTGGATCCCAGCTCCGG AGG Exonic