ID: 1029553039

View in Genome Browser
Species Human (GRCh38)
Location 7:101248305-101248327
Sequence ACCAGGGGTTTGAGAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029553039_1029553044 -1 Left 1029553039 7:101248305-101248327 CCTTCAGCTCTCAAACCCCTGGT 0: 1
1: 0
2: 3
3: 25
4: 262
Right 1029553044 7:101248327-101248349 TGGCCACAGCTCCGCTACACAGG No data
1029553039_1029553047 16 Left 1029553039 7:101248305-101248327 CCTTCAGCTCTCAAACCCCTGGT 0: 1
1: 0
2: 3
3: 25
4: 262
Right 1029553047 7:101248344-101248366 CACAGGCAGTCCTCTCTGTTTGG 0: 1
1: 1
2: 0
3: 27
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029553039 Original CRISPR ACCAGGGGTTTGAGAGCTGA AGG (reversed) Intronic
900090248 1:917165-917187 ACCCAGGGCTTGGGAGCTGAAGG + Intergenic
900874430 1:5331347-5331369 ACCACGGGCTTTGGAGCTGAAGG - Intergenic
901265511 1:7907434-7907456 ACAAGGAGTTTGAGAGCAGCAGG + Intergenic
901988673 1:13094983-13095005 ACCAGCAGTTTGAGACCTGCTGG + Intergenic
901993140 1:13131784-13131806 ACCAGCAGTTTGAGACCTGCTGG - Intergenic
902472214 1:16656953-16656975 ATCTGGGGATTGGGAGCTGATGG + Intergenic
902486589 1:16750493-16750515 ATCTGGGGATTGGGAGCTGATGG - Intronic
903922154 1:26807534-26807556 GCCAGGGGTTGGAGAGCAGGGGG - Intergenic
906609618 1:47192451-47192473 ACCTGGGACTTGAGTGCTGAGGG - Intergenic
906711319 1:47932032-47932054 AGGAGGAGTTTGAGAGGTGAAGG + Intronic
907382826 1:54105265-54105287 CCCAGGGGGCTGACAGCTGAAGG - Intronic
908221161 1:62008020-62008042 ACCAGGGCTTTGGGAAATGATGG + Intronic
911056842 1:93716017-93716039 AGCAGAGGTTTGCGAGCTGCAGG + Intronic
912271549 1:108215576-108215598 CCCAGGAGTTTGAGATCAGACGG - Intergenic
912523010 1:110259300-110259322 AACAGGTGTTTGAGAGGGGACGG + Intronic
912852846 1:113141828-113141850 AGAAGGGTTTTGATAGCTGAGGG - Intergenic
913006893 1:114642159-114642181 ACCAGGAGTTTGAGACCAGCCGG - Intronic
914341851 1:146766588-146766610 ACGAGGGGCAAGAGAGCTGAGGG + Intergenic
914881280 1:151548841-151548863 ACCTGGGGAGTGAGAGCTGGGGG + Intronic
915616644 1:157044456-157044478 ACCAGGGTCCTGAGAGCTGGAGG - Exonic
916887080 1:169080012-169080034 CCCAGGAGTTTGAGAGCAGCGGG - Intergenic
919049414 1:192494863-192494885 ACCAGGAGTTTGAGACCTGGTGG - Intergenic
919687524 1:200498099-200498121 GCCAGGAGTTTGAGACCAGATGG - Intergenic
921467226 1:215503244-215503266 AGCAGGGGTTGGGGAGCAGATGG + Intergenic
921523085 1:216181410-216181432 ACAAGGTGGCTGAGAGCTGAAGG - Intronic
921604356 1:217137483-217137505 GCCTGGGGCTCGAGAGCTGACGG + Intronic
922506817 1:226131232-226131254 ACCAGGAGTTTGGGAGGTCATGG + Intergenic
922915028 1:229250206-229250228 ACCAGGAGTTTGAGACCAGCTGG - Exonic
924107141 1:240660212-240660234 ACCAGAGGTTTTTGAGTTGAGGG - Intergenic
1063575951 10:7262076-7262098 TTCAGAGGTTTGAGAGCTAATGG - Intronic
1064002735 10:11677105-11677127 ACCATGGGTTTGAGACATGGCGG + Intergenic
1065965597 10:30767948-30767970 AGCAGGGGTTTGAGAGCTGCAGG - Intergenic
1066485057 10:35835291-35835313 GTCATGGGTTTGTGAGCTGAGGG - Intergenic
1066594553 10:37035933-37035955 GCCAGGGTTTTGAGAGGTGATGG - Intergenic
1067191182 10:44069442-44069464 TCCACTGGTTTGAAAGCTGAGGG + Intergenic
1067569168 10:47359240-47359262 ACCAGGGCATAGAGAGTTGAAGG - Intergenic
1069775298 10:70923743-70923765 ACCAGGGGGCTGAGTCCTGATGG - Intergenic
1071222885 10:83490452-83490474 ACCAGAGCAGTGAGAGCTGATGG + Intergenic
1072653907 10:97317639-97317661 TCCAGGAGTTTGAGACCGGACGG + Intergenic
1072708862 10:97702368-97702390 ACCAGGAGTTGGAGTACTGAGGG - Intergenic
1073407231 10:103308659-103308681 CCCAGGGGTTTGAGACCAGCCGG + Intronic
1073650319 10:105351810-105351832 GCCTTGGGTTTGAGACCTGATGG + Intergenic
1073705969 10:105984738-105984760 GCCAGGAGCTTTAGAGCTGAGGG + Intergenic
1074097605 10:110327852-110327874 ACCAGTAGTTTTAGAGCTTAAGG - Intergenic
1075607174 10:123820360-123820382 ACCTGGGGTCTGAGCTCTGATGG - Intronic
1075714816 10:124550064-124550086 CCCAGGGGTTAGAGAACTAAGGG + Intronic
1076245608 10:128945282-128945304 ACCTGGGGTTTGGGAGGAGATGG - Intergenic
1076980030 11:199355-199377 ACCTGGGGTCTGAGAGGTAAAGG - Exonic
1078421456 11:11216316-11216338 ACCATGGGTCTGAGGGCTGCAGG + Intergenic
1078533804 11:12157157-12157179 ACCAGGGTTTTGATAAATGATGG - Intronic
1081372995 11:42326867-42326889 ACAAGGGGACTGAGAGCTGAGGG - Intergenic
1081466968 11:43329129-43329151 ACCAGGAGTTTGAGACCAGCTGG + Intronic
1084366031 11:68699848-68699870 ACCAGGGGCTAGGGAGGTGATGG + Intergenic
1084655632 11:70515589-70515611 GCCAGGAGTTTGAGACCTGCTGG + Intronic
1085587091 11:77719034-77719056 GCCAGGAGTTTGAGACCAGATGG + Intronic
1085589209 11:77741849-77741871 ACCAGGGATTAGGGAGGTGAGGG - Intronic
1085893912 11:80613920-80613942 GCCAGGGTTTTGAAAGGTGATGG + Intergenic
1087912752 11:103772678-103772700 TCCAGGAGTTTGAGACCTGCCGG + Intergenic
1088607537 11:111545791-111545813 TACATGGGTTTGGGAGCTGAGGG - Intronic
1088905730 11:114154295-114154317 ACCAGGGGTTTGTTAGCTCCTGG - Intronic
1089657159 11:119957551-119957573 ACCAGGAGTTTGAGACCAGCTGG + Intergenic
1090212811 11:124934875-124934897 ATCTGGGGATTGAGAGGTGAGGG - Intronic
1090693105 11:129206420-129206442 ACCAGGAGTTTGAGACCAGCCGG - Intronic
1091511281 12:1129260-1129282 ACCAGGAGTTTGAGACCAGCCGG + Intronic
1092090747 12:5801899-5801921 ACCAGGTGTTGGAGAGCCCAGGG - Intronic
1093470625 12:19497680-19497702 ACCAGGAGTTTGAGACTTGGTGG - Intronic
1094121489 12:26979391-26979413 ACCTGGGGTTTGGCAGCGGATGG + Intronic
1095132547 12:38561111-38561133 ACACAGGGTCTGAGAGCTGAGGG + Intergenic
1095312927 12:40722087-40722109 ACAAGGTGTTTGTTAGCTGATGG - Intronic
1096080107 12:48827485-48827507 ACCGGGGAATTGAGAGTTGAGGG + Intronic
1097146158 12:56940796-56940818 ACTGGGGCTTGGAGAGCTGAAGG - Intergenic
1097151875 12:56985273-56985295 ACTGGGGCTTGGAGAGCTGAAGG - Intergenic
1098592054 12:72225826-72225848 CCCAGGGGTTGGAGAAATGAAGG + Intronic
1099324953 12:81203104-81203126 ACCAGAGGCTTGAGAACTCAGGG + Intronic
1100812497 12:98353166-98353188 ATTAGGGGGTTGAGAGCAGAAGG + Intergenic
1101154847 12:101917608-101917630 CCCAGGAGTTGGAGAGCTGGAGG + Intronic
1101659359 12:106752416-106752438 ACCAGGTGTGTGAGAGCAAATGG - Intronic
1102030343 12:109736707-109736729 CCCAGTGGTTGGAGTGCTGACGG + Intronic
1102299768 12:111762756-111762778 ACCAGGGATGAGAGAGCTGCTGG + Intronic
1102914357 12:116741899-116741921 CCCAGGGCTTTGAGAGATCAAGG - Intronic
1103374938 12:120448265-120448287 ACCAGGAGTTTGAGACCATATGG - Intronic
1103568385 12:121828628-121828650 AACAGGGATTTGAGTGCTGAAGG + Intronic
1103939182 12:124492718-124492740 AGGAAGGGTTTGAGGGCTGAGGG + Intronic
1105965498 13:25380201-25380223 ACCAGGGAGATGAGAGATGAGGG + Intronic
1106320606 13:28634409-28634431 ACCAGGGTATTGAGAGCTGAGGG - Intergenic
1108912165 13:55568442-55568464 ACCAGGGGTTGGCAAGCTAAAGG - Intergenic
1109957082 13:69582326-69582348 AGTACTGGTTTGAGAGCTGAGGG + Intergenic
1110118999 13:71858657-71858679 ACCAGGGACTGGAGAGCTGTTGG - Intronic
1110508487 13:76319759-76319781 ACTAGGGGTTGGAGTGGTGAGGG - Intergenic
1110899079 13:80797958-80797980 GCCAGGAGTTTGAGACCTGCTGG + Intergenic
1112406988 13:99129999-99130021 TCCAGAGGTTTGAGAGAGGAAGG + Intergenic
1113545526 13:111146135-111146157 ACCTGGGGTGTGAGATTTGATGG + Intronic
1113963809 13:114140353-114140375 GCCAGGGATTTGTGGGCTGAGGG - Intergenic
1115264003 14:31482205-31482227 ACCAGGAGTTTGGGACCAGACGG + Intergenic
1116859106 14:49979389-49979411 CCCAGGCCTTTCAGAGCTGATGG + Intergenic
1120119421 14:80660018-80660040 ACCAGGGATTGCAGATCTGATGG + Intronic
1120604653 14:86559453-86559475 ACCAGGAGTGTGATACCTGATGG + Intergenic
1121079122 14:91093593-91093615 ACCAGGAGTTTGAGACCAGCTGG + Intronic
1121227851 14:92334459-92334481 ATCAGTGGATTGGGAGCTGAAGG + Intronic
1121541862 14:94733773-94733795 ACCAGGGATTTGGGACCTGAAGG - Intergenic
1122030549 14:98908437-98908459 ATCCTGGGGTTGAGAGCTGAAGG - Intergenic
1122061144 14:99137472-99137494 ACCACAGATTTGAGAGCTGGTGG - Intergenic
1122407976 14:101511760-101511782 CCCAGAGGCCTGAGAGCTGAGGG - Intergenic
1122879424 14:104683391-104683413 ACCAGGGGTGTCAAAGCAGAAGG + Intergenic
1124169980 15:27363947-27363969 TCCAGGAGTGTGAGATCTGATGG + Intronic
1124450740 15:29787508-29787530 GCTAGGGGATTGAGAGATGATGG - Intronic
1124957044 15:34366706-34366728 CCCTGGGGTTGGAGAGATGAAGG - Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126218682 15:46186672-46186694 ACCAGGTATTTGAAAGCTCATGG - Intergenic
1127083962 15:55407921-55407943 GCCAAGGGTGGGAGAGCTGACGG - Intronic
1130931307 15:88430130-88430152 AGCAGGGGACTGAGAGCTGCAGG - Intergenic
1130989716 15:88869111-88869133 ACCAAAGGTGAGAGAGCTGAGGG - Intronic
1132009683 15:98265364-98265386 GCCAGGGGTCAGAGAGCTAAAGG + Intergenic
1133229429 16:4359645-4359667 AGCAGGTGTTTCAGAGCTGAAGG + Intronic
1133485868 16:6217802-6217824 ACCAAGGGTTTGAGACCAGCCGG + Intronic
1133829685 16:9310160-9310182 ACCAAGGCTGTGAGAGCTGAAGG - Intergenic
1134221060 16:12354412-12354434 ACCAGGGTTTTGACAGCTTATGG + Intronic
1134560436 16:15204525-15204547 GCCAGGTGGTTGAGAGCTGTAGG - Intergenic
1134920974 16:18116139-18116161 GCCAGGTGGTTGAGAGCTGTAGG - Intergenic
1135337481 16:21615437-21615459 ACCAGGTGTTTGAGACCAGCTGG - Intronic
1135774563 16:25245312-25245334 GCCAGGAGTTTGAGAGCAGCTGG - Intronic
1136473415 16:30496853-30496875 ACCAGGAGTTTGAGACCAGCTGG - Intronic
1139992424 16:70950837-70950859 ACGAGGGGCAAGAGAGCTGAGGG - Intronic
1140564680 16:76027356-76027378 ACAAGGGGTTTGTGAGCTGTGGG + Intergenic
1142613780 17:1123712-1123734 TGCTGTGGTTTGAGAGCTGAAGG + Intronic
1144747580 17:17626142-17626164 AACAGGGATTTGAGGGCTGCAGG + Intergenic
1146311598 17:31772949-31772971 GCCAGGAGTTTGAGACCAGATGG - Intergenic
1147433714 17:40392994-40393016 CCCAGGGGTTTGAGATCAGCTGG + Intronic
1147962404 17:44176142-44176164 CCCAGGGGTTTGAGACCAGCTGG + Intronic
1148029194 17:44608309-44608331 AGCAGGGGGCTGAGGGCTGAGGG + Intergenic
1148740513 17:49890030-49890052 GCAAGGGGTTGGAGGGCTGATGG + Intergenic
1149461100 17:56831038-56831060 ACCAGGGGTCTGAGAATGGAGGG + Intronic
1149747049 17:59108574-59108596 CCCTGGGGTTTGAGAGCCAACGG + Intergenic
1149904183 17:60510190-60510212 ACCAGGAGTTTGAGACCAGCCGG + Intronic
1150646153 17:66978650-66978672 ATCAGGCTTTTCAGAGCTGAGGG - Intronic
1151844547 17:76643241-76643263 TACAGGAGTTTGAGAACTGATGG - Intronic
1152140446 17:78533360-78533382 GCCATTGGTCTGAGAGCTGATGG + Intronic
1152546947 17:81004827-81004849 ACCAGGAGGGTGACAGCTGAAGG - Intronic
1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG + Intronic
1153594208 18:6707945-6707967 CCCAGGGGTTTGAGACCAGCCGG - Intergenic
1153838824 18:8988379-8988401 ACCAGGAGCCTGAGAGCTGCAGG + Intergenic
1154984097 18:21531741-21531763 ACCAGGAGTTCGAGAGGTGGTGG + Intronic
1155890696 18:31264819-31264841 ACCAAGGTTTTGAGAGTTGAGGG + Intergenic
1156503878 18:37577007-37577029 ACCAGGGGGCTGTGGGCTGAGGG + Intergenic
1157146959 18:45173573-45173595 CCCAGGTGTTTGGGTGCTGATGG + Intergenic
1157760480 18:50260252-50260274 ACCAGGGGTCTGAAAACCGAGGG + Intronic
1158723591 18:59947921-59947943 GCCAGGAGTTTGAGACCAGATGG + Intergenic
1160017439 18:75155402-75155424 CCCTCGGGTTTGAGAGGTGAAGG + Intergenic
1162371116 19:10279990-10280012 GCCAGGGATTAGATAGCTGAAGG + Intronic
1163480652 19:17554267-17554289 ACCAGGAGTTTGAGAACAGCCGG + Intergenic
1163658539 19:18562405-18562427 ACCTGGGGTGGGAGAGTTGAAGG + Intronic
1164274413 19:23704096-23704118 ATCATGGGTTTGGGTGCTGATGG - Intergenic
1166098384 19:40555710-40555732 CCCAGGAGTTTGAGAACAGAGGG + Intronic
1166248843 19:41551642-41551664 ACTTGGGGTTTGAGTCCTGAGGG + Intronic
1167744316 19:51341703-51341725 ACCAGGGGTTTCAGAGAAGGGGG + Exonic
1202704610 1_KI270713v1_random:13747-13769 ATCTGGGGATTGGGAGCTGATGG + Intergenic
925681100 2:6422008-6422030 AGGAGGGGCATGAGAGCTGAGGG + Intergenic
929934668 2:46286100-46286122 ACCAGGGTTTTGGGAGCTCTGGG - Intergenic
932056020 2:68445134-68445156 ACCAGGGGTTTCAGAACAGAGGG - Intergenic
932577932 2:72972925-72972947 ACCAGGGTTTGGGGAGCTGGAGG + Intronic
934986721 2:98892982-98893004 GCCAGGGATTTGTGAGCTGGCGG - Intronic
937131512 2:119517631-119517653 ACCAGGGGGCAGAGAGCAGAGGG + Intronic
937877037 2:126833512-126833534 ACCAGGGGTTATAGGGCTGAGGG + Intergenic
937992947 2:127674435-127674457 ACGAGGGGCCTGAGAGCAGAGGG + Intronic
939285381 2:140122197-140122219 AGCAAGGGGTTGAGAGCTGTGGG + Intergenic
939776086 2:146390298-146390320 GCAAGGGGTTTGAGAGCTGCTGG - Intergenic
941074768 2:160994085-160994107 ACCTAGGGTTTAAGAGCTAAAGG + Intergenic
942761067 2:179398919-179398941 AATAGGGGCTTGAGAGCTAAAGG - Intergenic
943400388 2:187402501-187402523 ACCAGGTGCTTGAGAGATGCAGG + Intronic
943571181 2:189577155-189577177 CCCACGGGACTGAGAGCTGAAGG + Intronic
944322515 2:198364646-198364668 AGCAGGGGTTTTAGAGTTGTTGG - Intronic
947546524 2:231014591-231014613 ACCTGGGATTGCAGAGCTGAGGG - Intronic
947630326 2:231648607-231648629 AACAGGGGTGTCAGAGCTGGAGG - Intergenic
1168977897 20:1981713-1981735 ACCAGGAGTTTGAGACCAGCCGG + Intronic
1169144017 20:3240777-3240799 ACCAGGTGTTTGGGAGCTGCTGG - Intergenic
1171973632 20:31579988-31580010 ACCAGGAGCTTGAGAGCTTGAGG - Intergenic
1172771246 20:37383944-37383966 ATCAGGAGTTTGAGACCTGCCGG - Intronic
1173002795 20:39116934-39116956 ACCAGGGGCTGGAGAGAGGAGGG - Intergenic
1173078833 20:39846679-39846701 ACCAGGGCATTGGGAGCAGAGGG - Intergenic
1173227900 20:41172625-41172647 ACCAGGGGTCTGGAAGTTGAGGG - Exonic
1174215761 20:48914993-48915015 GCCAGGAGTTTGAGACCAGATGG - Intergenic
1174547361 20:51335558-51335580 TTCAGGGTTTTGAGTGCTGATGG + Intergenic
1175748214 20:61476540-61476562 ACCTGGGGCTGGAGAGTTGAAGG + Intronic
1175927565 20:62478366-62478388 ACCCGGGCTTTGAGGGCAGAGGG - Intergenic
1176269983 20:64231290-64231312 ACCAGGACTTGGGGAGCTGAGGG - Intronic
1177369169 21:20179717-20179739 GCCAGGGCTTTGAGAGCAGAAGG - Intergenic
1178913320 21:36693462-36693484 ACCTGGGCTTTGGGAGCTGCGGG - Intergenic
1182109552 22:27713249-27713271 GCCTGGGGTTTCAGAGCTGAGGG + Intergenic
1182217551 22:28731736-28731758 CCCAGGAGTTTGAGACCTGCTGG - Intronic
1185034835 22:48468324-48468346 ACCAGTGGTTTAACAGCTGTGGG + Intergenic
950631843 3:14287185-14287207 ACCAGCAGTTTGAGACCTGGAGG + Intergenic
951651758 3:24958919-24958941 CACAAGGGTTTGAGAGCTGCGGG - Intergenic
952038593 3:29234313-29234335 AGTTGGGGTTTGAGAGCTAATGG + Intergenic
952080419 3:29751789-29751811 ACAAGGGGTTTGAGTGCTGCGGG - Intronic
952109833 3:30109471-30109493 GCAAGGGGTTTGAGTGCTGCTGG + Intergenic
954086699 3:48250259-48250281 ACCAGAGGTTGGAGAGGAGAGGG - Intronic
954520055 3:51216918-51216940 ACCAGCACTGTGAGAGCTGAGGG - Intronic
958466019 3:94459718-94459740 AACAGGAATTTGAGAGTTGAGGG + Intergenic
959723240 3:109515689-109515711 GCAAGGGGTTTGAGAGCTGTGGG - Intergenic
961643010 3:128376531-128376553 ACCTGGGGTCTGCCAGCTGATGG - Intronic
963301108 3:143598052-143598074 ACCAGGGACTGGAGAGCTCAGGG - Intronic
965299661 3:166994477-166994499 ACAAGGGGTTTGAAAGTTGCAGG - Intergenic
967266414 3:187696064-187696086 ACGTGGGGCCTGAGAGCTGAAGG - Intergenic
968359615 3:198137976-198137998 ACCAGGGGTGGGAGAGGTCAAGG - Intergenic
968481919 4:837068-837090 GCCAGGGGTCTGGGAGCAGAGGG - Intergenic
969843962 4:9904974-9904996 ACCAGGAACCTGAGAGCTGAAGG - Intronic
970100934 4:12521746-12521768 ACATGGGGTCTGAGAGCAGAAGG - Intergenic
974025792 4:56732167-56732189 AGCAGGGCTTGGAGAGCTGGAGG - Intergenic
975246929 4:72130631-72130653 ACAAGGGGCTTGAGAGTTGCAGG - Intronic
976827684 4:89278950-89278972 ACCAAGGGTTTGGGAGATGAGGG - Intronic
979780528 4:124646383-124646405 GCCAGGAGTTTGAGACCAGAAGG - Intergenic
982240050 4:153290837-153290859 GCCAGGGGTTTGAGACCAGCCGG - Intronic
983099936 4:163612827-163612849 ACCTGGGGCTTGAGATTTGAAGG + Intronic
984097990 4:175455150-175455172 ACAAGGGGTTTGAGAGCTGTGGG - Intergenic
984153878 4:176169827-176169849 ACCAGTGGGTTGTGAGATGATGG + Intronic
985185860 4:187315034-187315056 ACCAGAGGTTTGGGAGATGTTGG + Intergenic
986611541 5:9572809-9572831 ACCAGAGATTTGAGGGTTGAGGG + Intergenic
988522778 5:31961319-31961341 ACCAGGCGTTTGAGGGCAGCTGG + Intronic
990590921 5:57263453-57263475 ACCAGGGTTTTCAGAGTTGATGG + Intronic
991426603 5:66498801-66498823 ACCAAGGGGATGACAGCTGAGGG + Intergenic
993308986 5:86304427-86304449 CCCAGGAGTTTGAGATCAGACGG + Intergenic
993814193 5:92520660-92520682 ACCAGAGGCTGGAGAGCAGAGGG - Intergenic
994756185 5:103796760-103796782 ACCAGGTGTTTGAGACCAGCCGG + Intergenic
996334762 5:122371101-122371123 ACCAGGAGTTTGAGACCAGCCGG + Intronic
997156695 5:131568567-131568589 ACCAGTGGTTTGAGAGGCCAAGG - Intronic
998463112 5:142323986-142324008 ACCAGGCGTGTGGGAGCTGGAGG - Intronic
999457284 5:151727906-151727928 ACCATGAGTTGAAGAGCTGATGG + Intergenic
999639958 5:153662582-153662604 TCCAGCGGAGTGAGAGCTGAAGG + Intronic
1001658272 5:173370866-173370888 ACCAGGGGTTGCTGAGCTGCTGG + Intergenic
1003104357 6:3203198-3203220 AACAGGTGTTTGAAGGCTGAGGG + Intergenic
1003466005 6:6380703-6380725 AACAGTGTTTTGAGAGATGAGGG - Intergenic
1005311947 6:24567289-24567311 ACCAGGAGTTTGAGACCAGCCGG + Intronic
1005589431 6:27309645-27309667 GGCAGGGGTTTGAGAGGTGGAGG + Exonic
1006145091 6:31954234-31954256 TCCTGGGGTGTGAGACCTGAGGG - Intronic
1007414470 6:41683788-41683810 ACGAGGGGTTTGGGTGCTGAGGG - Intergenic
1009723773 6:67509637-67509659 CCCAGGGCTTTGAGAGGTCAAGG + Intergenic
1009952930 6:70417421-70417443 GCCAGGAGTTTGAGACCTGCTGG - Intronic
1011357441 6:86487218-86487240 AACCTGGGTTTGAAAGCTGAGGG - Intergenic
1013105704 6:107025187-107025209 CCCAGGAGTTTGAGACCAGAAGG - Intergenic
1014867507 6:126550508-126550530 CCTAGGGGTTTGAGAGCAGCAGG - Intergenic
1014944222 6:127477720-127477742 ATGAAGGGTTTGAGAGCTGCTGG + Intronic
1015127408 6:129770159-129770181 ACCAAGGCTTTGAGAGCCCAAGG + Intergenic
1018206351 6:161440563-161440585 ACCAGGGGTCTGGGAGTTGCTGG + Intronic
1019042366 6:169117827-169117849 CACAGGGGGTTGAGAGCTGTAGG + Intergenic
1019260377 7:78675-78697 ACCAGGGGTGGGAGAGGTCAAGG + Intergenic
1021470155 7:20993018-20993040 ACCAGGTGAATTAGAGCTGAAGG - Intergenic
1024963994 7:55005473-55005495 ACCTGGGGTTTCAGAGCAGGTGG - Intergenic
1025604678 7:63030845-63030867 AGGAGGAGTTTGAGAGGTGACGG + Intergenic
1027809273 7:82873026-82873048 AACAGAGGTTTGTGAGTTGAGGG + Intronic
1027926715 7:84474579-84474601 ATCAGGAGTGTAAGAGCTGATGG + Intronic
1028230615 7:88302608-88302630 GCCAGGGCTCAGAGAGCTGATGG - Intronic
1029553039 7:101248305-101248327 ACCAGGGGTTTGAGAGCTGAAGG - Intronic
1029656330 7:101927445-101927467 ACCAGGAGTTTGAGACCAGCTGG + Intronic
1030218226 7:107068469-107068491 AAAAGGGGTTTGAAAACTGATGG + Intronic
1033161381 7:139000262-139000284 CCCAGGAGTTTGAGACCTGCTGG + Intergenic
1033575639 7:142681581-142681603 AGCTGGGGTTTATGAGCTGAGGG - Intergenic
1033633768 7:143189133-143189155 ACAAAGGATTTGAGAGCTGCAGG - Intergenic
1035930847 8:3778072-3778094 AACTGGAGTTTGAGAGCTGCTGG + Intronic
1036443458 8:8801746-8801768 CGCAGGGGTCTGAGAGTTGAGGG + Intronic
1036597025 8:10222823-10222845 ACCAGGGGCTGGAGAGATGTTGG + Intronic
1037441908 8:18925174-18925196 GCCAGGAGTTTGAGACCTGCCGG + Intronic
1038888990 8:31697273-31697295 ACCAAAGGTTTGCCAGCTGAAGG - Intronic
1040576825 8:48659620-48659642 AGCAGGGCTTTGGGAGTTGAGGG - Intergenic
1040908234 8:52491158-52491180 CCCAAGGGGTTGAGAGCTGCAGG - Intergenic
1042879877 8:73475348-73475370 ACAGGGGGTTTGAGAACAGATGG - Intronic
1045244807 8:100433790-100433812 AGCTGGGGTGTGAGAGCGGAAGG + Intergenic
1046637657 8:116689922-116689944 GCAAGAGGTTTGAGAGCTGGTGG + Intronic
1047621264 8:126610705-126610727 ACCAGGAGTTTGAGAACAGCTGG - Intergenic
1049157346 8:141075195-141075217 ACCAGGGCTGGGAGAGCTGTGGG - Intergenic
1049473995 8:142788476-142788498 GCCAGGGGCATGAGAGCTGCTGG + Intergenic
1050670842 9:7995670-7995692 AACAGGGGAGAGAGAGCTGAGGG - Intergenic
1051478300 9:17532631-17532653 GCCAGGGGTTTGAGAACAGATGG + Intergenic
1056050551 9:82763904-82763926 AGCTGGGGTCTTAGAGCTGATGG - Intergenic
1058321499 9:103636712-103636734 TCAAGGGGTTTGAGAGCTGTGGG + Intergenic
1060223112 9:121774734-121774756 ACCTGGGGGTTGAGGGCTGAGGG + Intronic
1060949657 9:127593665-127593687 CCCAGGAGTTTGAGAGTTCAAGG - Intergenic
1061890468 9:133616657-133616679 AGCAGGGGTGTGAGATTTGAGGG - Intergenic
1062744303 9:138201706-138201728 ACCAGGGGTGGGAGAGGTCAAGG - Intergenic
1062744322 9:138201797-138201819 ACCAGGGGTGGGAGAGGTCAAGG - Intergenic
1185610423 X:1391173-1391195 GCCAGGAGTTTGAGAGCAGCCGG - Intronic
1185945280 X:4368262-4368284 GCAAGGGGTTTGAGAGCTGTAGG + Intergenic
1186051574 X:5601736-5601758 ACCACGGGTTTGAGGAATGAAGG + Intergenic
1186541800 X:10408847-10408869 ACCAGGGTGCTGAGGGCTGACGG - Intergenic
1186974193 X:14882325-14882347 ACCAGGGGCTGGAGGGGTGAGGG + Intronic
1188378902 X:29467485-29467507 TCAAGGGGTTTGAGTGCTGCAGG - Intronic
1189244534 X:39553262-39553284 ACCAGGGGTTGGAAAACTGTAGG + Intergenic
1189997183 X:46650335-46650357 ACCAGTGGATGGACAGCTGAGGG - Intronic
1190733306 X:53238755-53238777 ACCAGGAGTTTGAGGGCTTTGGG - Intronic
1193467634 X:81868161-81868183 AGCAGAGGTTGGAGAGATGATGG - Intergenic
1196192703 X:112811242-112811264 AACAGGGATCTGAGAGGTGAGGG - Exonic
1200308048 X:155048273-155048295 ACCAGGGGAGTGAGAGCAGGAGG + Intronic