ID: 1029553997

View in Genome Browser
Species Human (GRCh38)
Location 7:101255041-101255063
Sequence TCTTGAGAAAGGGTCTTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029553997_1029554001 -8 Left 1029553997 7:101255041-101255063 CCGAGCAAGACCCTTTCTCAAGA No data
Right 1029554001 7:101255056-101255078 TCTCAAGAAGAAGGAGAAGCTGG No data
1029553997_1029554004 5 Left 1029553997 7:101255041-101255063 CCGAGCAAGACCCTTTCTCAAGA No data
Right 1029554004 7:101255069-101255091 GAGAAGCTGGCTGGGTGCAGTGG 0: 2
1: 13
2: 150
3: 1003
4: 4956
1029553997_1029554002 -4 Left 1029553997 7:101255041-101255063 CCGAGCAAGACCCTTTCTCAAGA No data
Right 1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG No data
1029553997_1029554003 -3 Left 1029553997 7:101255041-101255063 CCGAGCAAGACCCTTTCTCAAGA No data
Right 1029554003 7:101255061-101255083 AGAAGAAGGAGAAGCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029553997 Original CRISPR TCTTGAGAAAGGGTCTTGCT CGG (reversed) Intergenic
No off target data available for this crispr