ID: 1029554002

View in Genome Browser
Species Human (GRCh38)
Location 7:101255060-101255082
Sequence AAGAAGAAGGAGAAGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029553997_1029554002 -4 Left 1029553997 7:101255041-101255063 CCGAGCAAGACCCTTTCTCAAGA No data
Right 1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG No data
1029553996_1029554002 18 Left 1029553996 7:101255019-101255041 CCATTGCACTCAGTCTGGGTGAC No data
Right 1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029554002 Original CRISPR AAGAAGAAGGAGAAGCTGGC TGG Intergenic
No off target data available for this crispr