ID: 1029565431

View in Genome Browser
Species Human (GRCh38)
Location 7:101333985-101334007
Sequence GTGGGCTAAGCTCCACTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029565425_1029565431 15 Left 1029565425 7:101333947-101333969 CCTTGAAAAGTCTTTCCTGGGCA No data
Right 1029565431 7:101333985-101334007 GTGGGCTAAGCTCCACTTGAGGG No data
1029565426_1029565431 0 Left 1029565426 7:101333962-101333984 CCTGGGCAAAGCCAAGAAGACTT No data
Right 1029565431 7:101333985-101334007 GTGGGCTAAGCTCCACTTGAGGG No data
1029565422_1029565431 27 Left 1029565422 7:101333935-101333957 CCTCTGGCTTGTCCTTGAAAAGT No data
Right 1029565431 7:101333985-101334007 GTGGGCTAAGCTCCACTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029565431 Original CRISPR GTGGGCTAAGCTCCACTTGA GGG Intergenic
No off target data available for this crispr