ID: 1029570717

View in Genome Browser
Species Human (GRCh38)
Location 7:101366995-101367017
Sequence AGTTAACTACACCACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029570717_1029570721 25 Left 1029570717 7:101366995-101367017 CCTTCCCAGTGGTGTAGTTAACT 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1029570721 7:101367043-101367065 TTTGACTAATTGCTTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029570717 Original CRISPR AGTTAACTACACCACTGGGA AGG (reversed) Intronic
911577584 1:99596724-99596746 AGATAATTGCATCACTGGGATGG - Intergenic
912670988 1:111623772-111623794 AGAAAACTATACCACTGTGAGGG + Intronic
915995489 1:160558240-160558262 AGGTCAGTACACCCCTGGGATGG + Intronic
916924644 1:169505118-169505140 AGTTGACTTCATCTCTGGGATGG + Intergenic
922763404 1:228145896-228145918 AGTGAAGCACACCACTGGGAAGG - Intronic
1064015034 10:11765144-11765166 CGGTACCTACACCACTGGGCTGG - Intergenic
1064559742 10:16584381-16584403 TGTTAACTACATCACTAGGTAGG - Intergenic
1071575222 10:86720499-86720521 AGTTAACTTCAGAGCTGGGAAGG - Intronic
1072529087 10:96301447-96301469 AGCACACTACACCACTGGGCTGG + Intergenic
1080549070 11:33353385-33353407 GGTGAACTATGCCACTGGGATGG - Exonic
1088172746 11:107017546-107017568 AGGGGACTACAGCACTGGGAAGG - Intronic
1091055463 11:132414226-132414248 AGTTAACGGCAGAACTGGGAAGG + Intergenic
1091716186 12:2777917-2777939 AGTTAACAACACCACAGTGCAGG - Intergenic
1095123465 12:38445641-38445663 AGTAAACTGCACAATTGGGAAGG + Intergenic
1101181138 12:102219291-102219313 AGTTAGTTACAACACTTGGAGGG + Intergenic
1114704582 14:24712511-24712533 ATTCAACTACACCACAGGGCAGG - Intergenic
1114926479 14:27406745-27406767 AGTTATGTACACCACAGAGAAGG - Intergenic
1119280708 14:73405130-73405152 AGTTAACTATAACACTGGGATGG + Intronic
1125667051 15:41439465-41439487 AGTTAACACCATCACTCGGAGGG - Intronic
1126772520 15:52072256-52072278 AGCTAACTAGACTAGTGGGAGGG - Intergenic
1130802868 15:87284493-87284515 AATTAACTGAACCAATGGGATGG + Intergenic
1131582819 15:93661935-93661957 AGTCAACTACAACTATGGGAAGG - Intergenic
1146050311 17:29545815-29545837 AGTGAACACCAACACTGGGAAGG - Exonic
1153475002 18:5489348-5489370 TGTCAACTTCACCACTGAGATGG + Intronic
1158005445 18:52667206-52667228 AGTTACCTTCAGCCCTGGGAAGG - Intronic
1168697503 19:58412597-58412619 AGAAAACTACACCACTGGCTGGG - Intronic
930424246 2:51193641-51193663 AGTTCAGTACTCCCCTGGGATGG - Intergenic
932346038 2:70995545-70995567 CATTTACTACACCTCTGGGAGGG + Intergenic
934319358 2:91958351-91958373 AATTAGCTACGCCATTGGGAAGG + Intergenic
937613533 2:123892963-123892985 AGTAAACTACAGCACTGGACTGG - Intergenic
938662394 2:133500881-133500903 ACTTAAATACAACACAGGGAAGG + Intronic
1170425557 20:16231834-16231856 ATTTAACTGCCCCACTGTGATGG - Intergenic
1175506759 20:59491658-59491680 AGTCACCAACAACACTGGGATGG + Intergenic
1185368590 22:50448103-50448125 AGTATACACCACCACTGGGAGGG - Intronic
951808056 3:26668506-26668528 AGTTTTCTACATCACTGTGAAGG + Intronic
952110236 3:30114584-30114606 AGTGAACAACACCAGTGGAAAGG - Intergenic
954626890 3:52026969-52026991 TGTTAACTACAACAATGGAATGG - Intergenic
965147005 3:164918443-164918465 ACTTCACTTCACCACTTGGATGG + Intergenic
974483516 4:62476122-62476144 AGTTGACTATAGCAGTGGGAGGG - Intergenic
975696920 4:77022838-77022860 AGCTATCTACACCACCAGGAAGG + Intronic
975998333 4:80341442-80341464 AGGTCAGTACTCCACTGGGATGG + Intronic
976102815 4:81583466-81583488 AGTTACCTGCGTCACTGGGAGGG + Intronic
981018728 4:140003214-140003236 CTTTTACTACACCACTGGGTTGG + Intronic
995329763 5:110933811-110933833 AGCTAACCAAACCACTGAGATGG + Intergenic
997846190 5:137288073-137288095 ACTTAACTTCACCACTGTTATGG + Intronic
1000832822 5:166125251-166125273 AGCTCAATACATCACTGGGAAGG + Intergenic
1004935160 6:20500246-20500268 AGTCAAGTGAACCACTGGGAGGG - Intergenic
1008511007 6:52275692-52275714 AGTTAAATACATCCCTGTGACGG + Intronic
1010472276 6:76242620-76242642 TGATAACTACCCCACTAGGAAGG - Intergenic
1012962397 6:105636011-105636033 AGTTAACTCCAGCAATGGCAAGG + Intergenic
1014885617 6:126777153-126777175 AGTTACCTAGAGCACTGAGAAGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1022251954 7:28617171-28617193 ATTTAACAACATCCCTGGGAGGG + Intronic
1029570717 7:101366995-101367017 AGTTAACTACACCACTGGGAAGG - Intronic
1032149968 7:129420118-129420140 AGTTTACTAAAGCACTGGAATGG - Intronic
1033140450 7:138821766-138821788 AGTTAACAAGACCTCAGGGAAGG + Intronic
1038923795 8:32115285-32115307 AGTTATCTACACAGCTGGGGAGG - Intronic
1039021152 8:33208300-33208322 AGTTCAGCACCCCACTGGGAGGG + Intergenic
1054818009 9:69494506-69494528 AATTAACTACACCAGTGTAAGGG + Intronic
1055576071 9:77661323-77661345 AGTTAACGAAAACTCTGGGAAGG + Intergenic
1059509993 9:114836229-114836251 AGTTGACTAAACCACAGAGAAGG + Intergenic
1186991498 X:15073955-15073977 TGTTAACTACACAACTGAAAAGG - Intergenic
1189164269 X:38844800-38844822 AATTAACAACATCACTGGTATGG + Intergenic
1191161514 X:57334715-57334737 AGATAACTACACTACTTGGGAGG + Intronic
1192554679 X:72080205-72080227 GGTTATCCACACCGCTGGGATGG + Intergenic
1194479273 X:94400621-94400643 AGTGATCAACACCACTGGGATGG + Intergenic
1200739682 Y:6840126-6840148 AGTGTACTACATCATTGGGAAGG + Intergenic