ID: 1029573855

View in Genome Browser
Species Human (GRCh38)
Location 7:101390125-101390147
Sequence ACCTTTTAGGTCTCATGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029573852_1029573855 26 Left 1029573852 7:101390076-101390098 CCAAGAAATCATTGCCAATCTAG 0: 1
1: 0
2: 3
3: 34
4: 330
Right 1029573855 7:101390125-101390147 ACCTTTTAGGTCTCATGTTAAGG No data
1029573853_1029573855 12 Left 1029573853 7:101390090-101390112 CCAATCTAGTGTCATGAAGCTTT 0: 1
1: 1
2: 5
3: 50
4: 237
Right 1029573855 7:101390125-101390147 ACCTTTTAGGTCTCATGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029573855 Original CRISPR ACCTTTTAGGTCTCATGTTA AGG Intronic
No off target data available for this crispr