ID: 1029574613

View in Genome Browser
Species Human (GRCh38)
Location 7:101395288-101395310
Sequence TCTTTTAATCAGTCTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029574613_1029574616 -8 Left 1029574613 7:101395288-101395310 CCCACCACAGACTGATTAAAAGA 0: 1
1: 0
2: 3
3: 28
4: 236
Right 1029574616 7:101395303-101395325 TTAAAAGAAATCTTTCTCGTAGG 0: 1
1: 0
2: 1
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029574613 Original CRISPR TCTTTTAATCAGTCTGTGGT GGG (reversed) Intronic
901552665 1:10007380-10007402 CTTTTTAATCAGGCTGTGGTTGG + Intronic
904018053 1:27439276-27439298 TGTTTTAATTATTCTGTGCTAGG - Intronic
904063796 1:27732116-27732138 TCTTTTAATTATTATGTGGCTGG - Intronic
905049255 1:35035042-35035064 TTTTATAATCCATCTGTGGTTGG + Intergenic
907037114 1:51226071-51226093 TCATTTAGTCAGTCTCAGGTGGG + Intergenic
907770557 1:57459130-57459152 TCTTTCAATCAATCTGTGAATGG + Intronic
909822647 1:80085725-80085747 TCTTTCAAACAGCCAGTGGTGGG - Intergenic
910979055 1:92940235-92940257 TGTTTTTAGCAGTCTGTGTTGGG - Intronic
911788585 1:101982129-101982151 TTTTATAATAAGTCTGTTGTTGG - Intronic
912028565 1:105209047-105209069 TCTATTAATCCTTCTGTGTTTGG - Intergenic
912970220 1:114274590-114274612 TCTTTACATCAGTCTGTAGATGG + Intergenic
914903816 1:151727992-151728014 TTATTTAATTAGTCTGGGGTGGG + Intronic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
917693092 1:177489086-177489108 TGTTTTAATCAGTTTTTGGGGGG - Intergenic
917991547 1:180385414-180385436 TCTTATAAACAGTGTGTAGTTGG - Intronic
918729162 1:187968671-187968693 TTTTTTAATTTGTCTTTGGTTGG + Intergenic
918895909 1:190345458-190345480 TCTTTTAATCAATTTTTGCTTGG + Intronic
919029153 1:192216981-192217003 TCATTTAACCAGTTTTTGGTTGG + Intergenic
919370657 1:196721954-196721976 TCTTTTGAGCAGCATGTGGTTGG + Intronic
920884430 1:209912853-209912875 TCTTTTACTCAGTCTCTGCAAGG - Intergenic
923320966 1:232832659-232832681 GCTTTTTTTCAGACTGTGGTGGG + Intergenic
1064047204 10:12027823-12027845 TAGTTTCATAAGTCTGTGGTAGG - Intronic
1064387904 10:14914131-14914153 TCTTGTAAGCAGTATGTTGTTGG - Intronic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1064423004 10:15206362-15206384 TAATTCAATCAGTCTGTGGTGGG + Intergenic
1064805996 10:19133768-19133790 TCTTTTAATTACACTGTAGTAGG - Intronic
1066564749 10:36709910-36709932 TATTTTAAAACGTCTGTGGTGGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067039950 10:42944417-42944439 TCCTTTAATCATTCTAGGGTAGG - Intergenic
1068036680 10:51768570-51768592 TCTTTTAATCAGTAAGTGCTAGG + Intronic
1069783532 10:70973145-70973167 TGTTTTAATAAGTGTGTAGTGGG - Intergenic
1070358448 10:75663381-75663403 TAATTTAACCAGTCTGAGGTGGG + Intronic
1070379698 10:75869586-75869608 TTATTTATTCGGTCTGTGGTGGG + Intronic
1071781464 10:88850530-88850552 TGTTTCACTCAGTCTATGGTAGG - Intronic
1072056403 10:91761539-91761561 TCTTGTAAGCAGTATTTGGTTGG - Intergenic
1072274700 10:93811892-93811914 TCTTTTAATCATTCTGTCAATGG - Intergenic
1072931007 10:99662086-99662108 TCTTGTAGTCAGTGTTTGGTTGG + Intronic
1073001331 10:100288219-100288241 TCTTTGAATTAATATGTGGTGGG - Exonic
1074266448 10:111908950-111908972 TATTTTAAACAGTCTGAGTTGGG + Intergenic
1077759336 11:5074575-5074597 GCTTTTAATCAGTGTGTGGTGGG - Intergenic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1079615012 11:22481424-22481446 TTTCTTTATCAGTCTGAGGTGGG + Intergenic
1080559174 11:33446428-33446450 TCTTTAAAGAACTCTGTGGTTGG + Intergenic
1080563626 11:33487678-33487700 TGATTTAATTAGTCTGAGGTGGG + Intergenic
1082090058 11:48081689-48081711 TCTTACAATGAGTCCGTGGTGGG - Intronic
1082637213 11:55611025-55611047 TCTTTAAATCAGTTTGTTTTAGG + Intergenic
1083117070 11:60471849-60471871 TCTTTTCAACAAACTGTGGTGGG + Intergenic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1085771943 11:79333389-79333411 TCATTTAATCTTTATGTGGTTGG + Intronic
1087578524 11:100022270-100022292 TCTTTTAGGCAGTATGTAGTTGG + Intronic
1088450696 11:109978278-109978300 TGTTTTAATCAGCCTGTGAAAGG + Intergenic
1090313199 11:125761484-125761506 TCTTATATACAGTGTGTGGTTGG + Intergenic
1091256345 11:134189936-134189958 TCTTATAAACAGTATGTAGTTGG + Intronic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1094636908 12:32235375-32235397 TCTTTGAATTAGTCTTTTGTTGG + Intronic
1094684821 12:32700978-32701000 TCATTTAAAAAGTCTGTGGCCGG + Intronic
1095418028 12:41997045-41997067 TGATTTAATCAGTCTCAGGTAGG + Intergenic
1095641176 12:44486745-44486767 TCTTTTGATGTGTGTGTGGTAGG + Intergenic
1098350668 12:69555985-69556007 TCTTTTGATCAGTGTGTGTGTGG + Intronic
1099138787 12:78943164-78943186 TCTTTTATCCCATCTGTGGTTGG + Intronic
1100849992 12:98699587-98699609 TCTTTAAATCAGACTGAAGTTGG - Intronic
1101834696 12:108287147-108287169 TCTTTTGCTAATTCTGTGGTAGG - Intergenic
1104654904 12:130567329-130567351 TCTAGTAATCAGTTTGTGGTGGG - Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1108219520 13:48218726-48218748 TCTTTAAATCAGTCTTTATTTGG - Intergenic
1109142743 13:58735479-58735501 TCTTTATATCAGTCTGTCATTGG - Intergenic
1111834129 13:93366162-93366184 TCTTTAAATCATTCTTTAGTAGG + Intronic
1112208980 13:97354507-97354529 TCTTTCTACCACTCTGTGGTGGG - Intronic
1112274937 13:98008302-98008324 ACTTTTTCTCAGTCTGTTGTAGG + Intronic
1112599100 13:100837793-100837815 TCTATTAATCATTCAATGGTAGG + Intergenic
1112858094 13:103795691-103795713 ACTTTTAATCAGTTTGGGTTTGG - Intergenic
1114679117 14:24469222-24469244 TGTTTTAATCATTTTGGGGTGGG - Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1116989443 14:51259612-51259634 TCTTTTAGGCAGTATGTAGTTGG + Intergenic
1117025133 14:51611346-51611368 TCATCTAATCAGTTTGAGGTAGG + Intronic
1117412177 14:55460553-55460575 GATTTTAATCTGTGTGTGGTGGG + Intergenic
1118419604 14:65586891-65586913 TCTTTTAAAGAGTATGTGCTGGG + Intronic
1119043856 14:71299815-71299837 TATTTTAATAAGTCTGGGGTGGG - Intergenic
1120208245 14:81609061-81609083 TCATTTAATCAGTCTGGAGTGGG + Intergenic
1121567491 14:94921624-94921646 TCCTTTAATTGGTCTGGGGTGGG - Intergenic
1122395926 14:101430625-101430647 TCTTTTCAACAGTTTGTGCTGGG - Intergenic
1125672142 15:41481336-41481358 TCTTTGTATCAGTCTGTCATGGG + Exonic
1127808471 15:62542595-62542617 TATTTGAATCAGTCTGGGGTAGG - Intronic
1129416759 15:75387664-75387686 ACTTTTAATAATTCTGAGGTTGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131780109 15:95846799-95846821 ACTTTTAATCTGTGAGTGGTGGG + Intergenic
1132324403 15:100955961-100955983 TGTTTTTATCTGGCTGTGGTAGG + Intronic
1134817933 16:17221585-17221607 TGTTTTAAGCAGAGTGTGGTGGG + Intronic
1136701271 16:32145205-32145227 TTTTTTCATCAGTATCTGGTGGG - Intergenic
1137735521 16:50720340-50720362 GCATTTCATCAGTCTGGGGTGGG - Intronic
1137986382 16:53111583-53111605 TCATTTCATCAGCCTGGGGTTGG - Intronic
1138653038 16:58472613-58472635 TCTTTGTATCAGTCTGAGTTCGG - Intronic
1138723816 16:59113757-59113779 TCTTATCATGAGTCTGGGGTGGG - Intergenic
1141205093 16:81927379-81927401 TGTTTTAATCAGGTTGTGTTGGG + Intronic
1143267105 17:5646788-5646810 TCTTTTAAAGAGTCTGTTTTTGG + Intergenic
1146488354 17:33262076-33262098 TCCTTTGAACAGTCTGTGCTCGG + Intronic
1147940229 17:44041635-44041657 TCTTTTGATCAGTTTGTGGATGG - Intronic
1150814365 17:68381000-68381022 TAATTTAATAAGTCTGGGGTGGG - Intronic
1151113721 17:71708768-71708790 TCTTTTAATCATTTTGTTGTAGG + Intergenic
1151813913 17:76461659-76461681 TCAATCAATCAGTCAGTGGTGGG + Intronic
1157932754 18:51841232-51841254 TCTTCTATTCATTCTTTGGTAGG - Intergenic
1158170733 18:54596447-54596469 TGATTTAATTAGTCTGGGGTGGG - Intronic
1158521182 18:58172313-58172335 TCTTTTAGACGCTCTGTGGTGGG + Intronic
1161213137 19:3078498-3078520 TATTTTTTTCAGTCTGTGGGTGG - Intergenic
1162291068 19:9780935-9780957 TGTTTTAATTGGTCTGAGGTAGG + Intronic
1164966506 19:32489485-32489507 TCTTTTAAACTGTCTGTGGTAGG - Intergenic
1165603873 19:37082061-37082083 TCTTTTAACCTGTTTGTGTTTGG + Intronic
1166121446 19:40689833-40689855 TATTTTATTCAGGCTGGGGTGGG + Intronic
1168439980 19:56356282-56356304 CCTTTTAAACAATCAGTGGTGGG + Intronic
1168441263 19:56369155-56369177 TCTTTTAAGCACTGTGTGGTGGG + Intergenic
925698172 2:6605111-6605133 TCTTTTAATCAATCTGCTGTAGG + Intergenic
929727120 2:44441597-44441619 TATATTATTCAGTCTGTGTTGGG - Intronic
930372880 2:50526553-50526575 TCATTTAATCACTGTGTGTTAGG + Intronic
930550231 2:52825412-52825434 TCATTAAATGAGTCTGGGGTAGG - Intergenic
931101311 2:59004556-59004578 GCTTTTCATCACTCTGGGGTTGG + Intergenic
932061141 2:68499290-68499312 TCTTTTAATCATGGTGAGGTTGG + Intronic
935075229 2:99735973-99735995 TAATTTAATCATACTGTGGTTGG + Intronic
937359859 2:121221384-121221406 TTTTTTACTTAGTCTGTGTTTGG - Exonic
939896445 2:147797420-147797442 TATTTTAATAAATCTATGGTAGG + Intergenic
940904428 2:159156400-159156422 ACTTTTATTCAGACTGTAGTTGG + Intronic
941239572 2:163019292-163019314 TTTTTTAATCAGTCCTGGGTAGG - Intergenic
941665242 2:168238171-168238193 TCTCATAATCATTCTGTGGATGG - Intronic
941806825 2:169718151-169718173 TCTTTCAATAAGCCTGGGGTGGG + Intronic
942460756 2:176166814-176166836 TCTTCTAATTAGTCTTTGGTAGG - Intronic
943098875 2:183462568-183462590 TCTTTTCACCAGTCTATGCTGGG - Intergenic
943795349 2:191986247-191986269 TCTTTCAAACAGTCAGTGTTTGG + Intronic
943856804 2:192805484-192805506 TCTTTTAAACAGCATATGGTTGG - Intergenic
948196574 2:236101230-236101252 CCTTTTAATCTGCTTGTGGTGGG - Intronic
948904911 2:240974979-240975001 TCTTTTGATCAGTGTCTGGGTGG + Intronic
1168731184 20:82593-82615 GGTTTTAATCAGTCTGGGGTTGG - Intergenic
1169456759 20:5758858-5758880 TCTTTTGAGAAGTCTGTGGAGGG + Intronic
1170471742 20:16674694-16674716 TGATTTAATTAGTCTGTGGTGGG + Intergenic
1170640948 20:18152154-18152176 TCTTTTAAGCTGTGTGTGGTGGG + Intronic
1170905493 20:20512436-20512458 TCTTTTTATCAGTTTGTGGTTGG - Intronic
1170930403 20:20764749-20764771 TCTTTTCTTCATTCTGAGGTTGG - Intergenic
1171970613 20:31562680-31562702 TTTTTTAATCACTCTGTGCCAGG + Intronic
1172726959 20:37051856-37051878 TCTTATAGTCAGTGTGTAGTTGG - Intronic
1173276066 20:41584160-41584182 TCTTTTGATTAGTATGTGCTTGG - Intronic
1173469811 20:43314338-43314360 TCTTTTAAGAAGCCTTTGGTAGG + Intergenic
1175339081 20:58216246-58216268 CATTTTGCTCAGTCTGTGGTAGG - Intergenic
1176965928 21:15211339-15211361 TCTTTGATTCAGTATGTGGGGGG + Intergenic
1178034823 21:28568626-28568648 TCTTTTCATCTGTCTGTAGTAGG + Intergenic
1179016503 21:37598273-37598295 TTTTTCAAACAGTGTGTGGTCGG + Intergenic
1179556914 21:42184882-42184904 ACTTTTAATTGGTCAGTGGTAGG + Intergenic
1182058758 22:27381826-27381848 TGATTTAATTAGTCTGGGGTGGG + Intergenic
1183581412 22:38728687-38728709 TCTTGGAATCAGTCTTTGGCTGG + Intronic
1184382547 22:44154843-44154865 TGGTTTATGCAGTCTGTGGTGGG + Intronic
1185010944 22:48313821-48313843 TCTTTGACTCGGACTGTGGTTGG + Intergenic
949255575 3:2041754-2041776 TTTTTTAATAAGTCTCTGGATGG - Intergenic
949847420 3:8385984-8386006 TATATTACCCAGTCTGTGGTTGG + Intergenic
949938840 3:9137895-9137917 GCTTTAACTCAGTCTCTGGTAGG - Intronic
951366236 3:21786559-21786581 TCTTTGAATCAATCTATGCTAGG + Intronic
952602600 3:35103654-35103676 TGTTTTAATTAGTTTGTAGTAGG - Intergenic
953035628 3:39208162-39208184 CCTGTTAATCTGTCTGTGGTTGG + Intergenic
953040236 3:39249880-39249902 TCTTTGAGTCAGTTTGTGCTGGG + Intergenic
954496540 3:50969386-50969408 TCTTGTAAGCAGTATATGGTTGG + Intronic
954679869 3:52338723-52338745 GCTTTTAAGAAGTCTGAGGTTGG + Intronic
956099784 3:65755532-65755554 TCTTCTAGACAGTCTGTGATAGG + Intronic
956228873 3:66990284-66990306 TCTTATAATATGTCTGTGATTGG + Intergenic
959250880 3:103943259-103943281 TCTTTTAGGCAGTCTATAGTTGG + Intergenic
965622061 3:170651647-170651669 TGATTTAATCAGTCTGGAGTGGG - Intronic
966031114 3:175349050-175349072 TCTTTTAATTAGTCTTTTGTGGG + Intronic
971070998 4:23091178-23091200 TCTTTCATTCAGCCTGTGTTTGG - Intergenic
971539779 4:27801351-27801373 TCTTTTCACCAGTGTGAGGTGGG + Intergenic
973062842 4:45750561-45750583 TTTTTTAATCAGTCATTGGCTGG + Intergenic
973097645 4:46223004-46223026 TTCTTTACTCAGTCTGAGGTGGG - Intergenic
975078362 4:70242471-70242493 CCTTTGGGTCAGTCTGTGGTGGG - Intergenic
975689050 4:76948120-76948142 TTATTTATTCAGTCTGTGGGCGG - Intergenic
976897826 4:90133015-90133037 TGAATCAATCAGTCTGTGGTGGG - Intronic
980068901 4:128221732-128221754 TATTTTAATGAGTCAGTGGATGG + Intronic
980668401 4:135970758-135970780 TGTTTTAAACACTTTGTGGTTGG - Intergenic
981591913 4:146373745-146373767 TAATTTAATCAGTCTGGAGTGGG + Intronic
981648592 4:147028784-147028806 TCTTTTAATCTGGCTGCTGTAGG + Intergenic
985034228 4:185821723-185821745 TCTTTTTATGACTCTATGGTGGG - Intronic
986384581 5:7219071-7219093 TCTTTTTATCAGTCTCTACTTGG - Intergenic
986522707 5:8638453-8638475 TCTTGTACTCTGTGTGTGGTGGG + Intergenic
989322216 5:40149110-40149132 ACTTTTAATTATTCTGGGGTGGG + Intergenic
990255001 5:53958649-53958671 TCTTATAAACAGTATATGGTTGG - Intronic
993897295 5:93551683-93551705 TCTTATAATCAGTCTAAAGTTGG - Intergenic
995241842 5:109893860-109893882 AATTTTAACCATTCTGTGGTAGG - Intergenic
995607550 5:113873378-113873400 TCTATTTATCAGTCTTTGTTAGG - Intergenic
995731297 5:115244910-115244932 TCTTTTAATCCTTCTCTAGTTGG + Intronic
998443476 5:142180900-142180922 TCTTTAATTCATTCTGTGGCTGG + Intergenic
998481516 5:142466940-142466962 TCTTTTAATTAGTATGTAATTGG + Intergenic
999506346 5:152201539-152201561 TCTCTAAATAATTCTGTGGTTGG + Intergenic
1000718079 5:164671838-164671860 TGGTTTAATTGGTCTGTGGTGGG + Intergenic
1003454309 6:6267100-6267122 TCTTTAAAAGAGTCTTTGGTAGG + Intronic
1003800905 6:9666009-9666031 TCTTTTAATAATTATGTGGTGGG - Intronic
1004141770 6:13024698-13024720 ACTATTAAGCAGCCTGTGGTCGG + Intronic
1005169060 6:22960500-22960522 TGCTTTAATCAATCTGTGATGGG + Intergenic
1007364658 6:41382978-41383000 TCTTCTACACAGTCTGTGCTGGG + Intergenic
1007400996 6:41602225-41602247 TTTTTTAAACAGTATCTGGTGGG - Exonic
1008006345 6:46413799-46413821 TCTTTCAATCTGTCAGGGGTCGG - Intronic
1010686868 6:78863662-78863684 TCTTTTTATCTGTTTCTGGTGGG - Intergenic
1010713563 6:79203501-79203523 TCTTTGAATGATTCTGAGGTAGG + Intronic
1012801556 6:103835654-103835676 TATTCAAATCAGTCTGTGTTGGG - Intergenic
1013049169 6:106515289-106515311 CCTTTTAATCAGTCTGAAGTAGG + Intronic
1013741004 6:113285007-113285029 TCTTTTAATCAGTGTTTGCATGG + Intergenic
1013989570 6:116237737-116237759 TGTTTCAACCAGTCTGGGGTTGG + Intronic
1016098889 6:140073139-140073161 TCTTCTCATCAGTATGTGTTTGG + Intergenic
1016289448 6:142512386-142512408 ACTTTTAATCTATCTGGGGTTGG + Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017478465 6:154824534-154824556 TGCTTTACTCAGTCTGTGGTAGG + Intronic
1017613795 6:156222090-156222112 TCTTTTACTTATTGTGTGGTTGG - Intergenic
1020591383 7:10142386-10142408 TATTTTAACCAGTTTGTGATGGG - Intergenic
1021103897 7:16615407-16615429 TGTATTCATCAGTCTGTTGTTGG - Intronic
1021682791 7:23151660-23151682 TTATTTAATTAGTCTGTGGTAGG + Intronic
1021856783 7:24864857-24864879 TCTTTAAATTGGTCTGAGGTAGG - Intronic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1024081819 7:45862720-45862742 TCATTTCATCAGTCTGGGATGGG + Intergenic
1025859871 7:65316572-65316594 TCCTTTAATCAGTCTGTAAGGGG - Intergenic
1028532081 7:91849311-91849333 CCTTTTAATAAGTCTTTGGATGG - Intronic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1031012924 7:116542373-116542395 TGATTTAATTGGTCTGTGGTGGG + Intronic
1031782310 7:125984294-125984316 TCTTTTAAGAAGCCTATGGTTGG + Intergenic
1031791051 7:126104984-126105006 TCTTGTAATAAGCCTATGGTTGG - Intergenic
1035978809 8:4345052-4345074 TGATTAAGTCAGTCTGTGGTTGG + Intronic
1037121331 8:15290694-15290716 TGATTTAGTCAGTCAGTGGTGGG - Intergenic
1037781285 8:21870944-21870966 GCTTTTAATCATTCTTTGCTAGG - Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038022731 8:23563636-23563658 TGTTTTTGCCAGTCTGTGGTAGG + Intronic
1038205957 8:25465506-25465528 TCATTTTATCAGTCTTTGGTTGG + Intronic
1038650333 8:29397102-29397124 TGTTTTCATCAATCTGTGCTAGG + Intergenic
1039890814 8:41684115-41684137 TCTGTAAAACAGTCAGTGGTTGG - Intronic
1040359604 8:46652520-46652542 TCTTTTATTCAGTCTATTGGAGG - Intergenic
1041853593 8:62421884-62421906 TCATATAGTCAGTATGTGGTGGG + Intronic
1043237344 8:77884702-77884724 TCTTTAAAGTAGTCTGTGGTAGG + Intergenic
1044076651 8:87830795-87830817 TGATTTAATTAGTCTGGGGTGGG + Intergenic
1044862733 8:96539011-96539033 TCCTTTAATCTGTATGTGTTGGG + Intronic
1045454298 8:102361153-102361175 ACTATTAAACAGTGTGTGGTGGG - Exonic
1047470115 8:125162732-125162754 AATTTAAATCAGCCTGTGGTAGG - Intronic
1048509165 8:135046829-135046851 TCTCTGATTCAGTCTGAGGTGGG + Intergenic
1049979264 9:889036-889058 TGATTTTGTCAGTCTGTGGTGGG + Intronic
1050395098 9:5187268-5187290 TCTTTTGATGAGTCTCTTGTGGG - Intergenic
1050440695 9:5660236-5660258 TCTTTTATTCAGTCTATCATCGG + Intronic
1052675353 9:31615343-31615365 TCTTTTAAACATAATGTGGTAGG - Intergenic
1056009452 9:82311761-82311783 TCTCTTAAGCAGTCTGTAGAGGG - Intergenic
1056590561 9:87963323-87963345 TCTTTTAACCAATATGTGGGGGG + Intergenic
1057051701 9:91928681-91928703 TCTTTGAAACAGTCTGTGAGGGG - Intronic
1058804474 9:108577698-108577720 TAATTTAATCAGTCTGTGCCAGG + Intergenic
1059582930 9:115571861-115571883 TCTGTTCATAAGTCTATGGTTGG - Intergenic
1060502312 9:124169859-124169881 TCTTTTAATTAGTGTTTGGAAGG + Intergenic
1062338010 9:136080987-136081009 TCTGTTAATCAGAATGTGCTTGG - Intronic
1203699073 Un_GL000214v1:120842-120864 TCTTTTAGTCAGACTGAGGATGG + Intergenic
1203700938 Un_GL000214v1:133136-133158 TCTTTTAGTCAGACTGAGGATGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1185988971 X:4871871-4871893 TCTTTTAATCATTTTTTTGTTGG + Intergenic
1186082708 X:5950909-5950931 TCTTATAATCATGTTGTGGTGGG - Intronic
1188599977 X:31950878-31950900 TCTTTTAAACAAACTATGGTTGG + Intronic
1188746394 X:33850139-33850161 TCTTTTTATCTCCCTGTGGTAGG + Intergenic
1189585052 X:42451501-42451523 TCTTTTGATATGTCTGTGTTTGG - Intergenic
1189955416 X:46272528-46272550 TTTTTTGATCAGTCTCTTGTTGG - Intergenic
1191746397 X:64493742-64493764 TCTTTTAATAATTTTGTGTTTGG - Intergenic
1192506565 X:71688889-71688911 TCTTTTATACAGTCTTTGGGTGG + Intergenic
1192520132 X:71792657-71792679 TCTTTTATACAGTCTTTGGGTGG - Intergenic
1194258331 X:91662736-91662758 TCTTTTAATTTGTCTGGTGTGGG + Intergenic
1194408812 X:93532010-93532032 TCTTTTAATCACTCTGTCCCAGG - Intergenic
1194567044 X:95502088-95502110 TCTTTTAATGTTTCTGTGATTGG - Intergenic
1196101802 X:111854473-111854495 TCATTTAGTCAGTCTGTGGAAGG - Intronic
1197470274 X:126859329-126859351 TTTTTTAATCTGTCTTTGTTTGG - Intergenic
1197628957 X:128835692-128835714 TGTTTTCATGAGGCTGTGGTAGG - Intergenic
1200166911 X:154042402-154042424 TTTTTTAACCTGTATGTGGTGGG - Intronic
1200425696 Y:3018325-3018347 TCCTTTAAGTAGTCTGTGGTAGG - Intergenic
1200523392 Y:4240926-4240948 TCTTGTAAACAGTATATGGTTGG + Intergenic
1200577100 Y:4902233-4902255 TCTTTTAATTTGTCTGGTGTGGG + Intergenic
1201380577 Y:13373307-13373329 TCTTTGAATTTGTCTGTGTTGGG - Intronic