ID: 1029574664

View in Genome Browser
Species Human (GRCh38)
Location 7:101395558-101395580
Sequence CAGCGGGGCTGGAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029574656_1029574664 14 Left 1029574656 7:101395521-101395543 CCGTCTGCAGGGGTTCCTGGGAA 0: 1
1: 1
2: 6
3: 24
4: 307
Right 1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG No data
1029574657_1029574664 -1 Left 1029574657 7:101395536-101395558 CCTGGGAAAAAAGCTCTTTAATC 0: 1
1: 0
2: 0
3: 11
4: 187
Right 1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029574664 Original CRISPR CAGCGGGGCTGGAGGGAAAA TGG Intronic
No off target data available for this crispr