ID: 1029575415

View in Genome Browser
Species Human (GRCh38)
Location 7:101400282-101400304
Sequence GGTGGGCTCGGTCATGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029575403_1029575415 26 Left 1029575403 7:101400233-101400255 CCTAGGGCTCAGGGGTTCAGGAG 0: 1
1: 0
2: 5
3: 49
4: 556
Right 1029575415 7:101400282-101400304 GGTGGGCTCGGTCATGGAGTGGG No data
1029575410_1029575415 -8 Left 1029575410 7:101400267-101400289 CCTTGCAGAAGGCCTGGTGGGCT 0: 1
1: 0
2: 1
3: 25
4: 212
Right 1029575415 7:101400282-101400304 GGTGGGCTCGGTCATGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029575415 Original CRISPR GGTGGGCTCGGTCATGGAGT GGG Intronic
No off target data available for this crispr