ID: 1029576319

View in Genome Browser
Species Human (GRCh38)
Location 7:101405887-101405909
Sequence CTGTGGGGCTGGCTCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029576310_1029576319 9 Left 1029576310 7:101405855-101405877 CCGCCAGTGCGCAGGCAAGGAGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data
1029576301_1029576319 24 Left 1029576301 7:101405840-101405862 CCCCGCCAGCCCTTCCCGCCAGT 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data
1029576307_1029576319 14 Left 1029576307 7:101405850-101405872 CCTTCCCGCCAGTGCGCAGGCAA 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data
1029576309_1029576319 10 Left 1029576309 7:101405854-101405876 CCCGCCAGTGCGCAGGCAAGGAG 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data
1029576304_1029576319 19 Left 1029576304 7:101405845-101405867 CCAGCCCTTCCCGCCAGTGCGCA 0: 1
1: 0
2: 0
3: 11
4: 186
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data
1029576311_1029576319 6 Left 1029576311 7:101405858-101405880 CCAGTGCGCAGGCAAGGAGCCGA 0: 1
1: 0
2: 1
3: 7
4: 67
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data
1029576306_1029576319 15 Left 1029576306 7:101405849-101405871 CCCTTCCCGCCAGTGCGCAGGCA 0: 1
1: 0
2: 1
3: 4
4: 110
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data
1029576302_1029576319 23 Left 1029576302 7:101405841-101405863 CCCGCCAGCCCTTCCCGCCAGTG 0: 1
1: 0
2: 0
3: 19
4: 314
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data
1029576303_1029576319 22 Left 1029576303 7:101405842-101405864 CCGCCAGCCCTTCCCGCCAGTGC 0: 1
1: 0
2: 4
3: 31
4: 478
Right 1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029576319 Original CRISPR CTGTGGGGCTGGCTCTCAGG TGG Intronic
No off target data available for this crispr