ID: 1029580491

View in Genome Browser
Species Human (GRCh38)
Location 7:101433836-101433858
Sequence CCAACCCAGGAGTGCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029580486_1029580491 -5 Left 1029580486 7:101433818-101433840 CCAGGCTGACTCTTCCCACCAAC 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 168
1029580484_1029580491 18 Left 1029580484 7:101433795-101433817 CCACAGAACACTGAAAGTGATTT 0: 1
1: 0
2: 3
3: 35
4: 307
Right 1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029580491 Original CRISPR CCAACCCAGGAGTGCCTTGA AGG Intronic
900388120 1:2419848-2419870 CCAGCCCAGGGCTGGCTTGAGGG - Intergenic
902685490 1:18074244-18074266 GCAACCCAGGCGTTCATTGACGG + Intergenic
903474534 1:23610484-23610506 CTAGCCCAGGAGCTCCTTGAGGG + Intronic
903780154 1:25815709-25815731 CCAGCCCTAGAGTGCCTGGACGG + Exonic
905704605 1:40045418-40045440 CCCACCCAGAAATTCCTTGAAGG - Intronic
906500771 1:46340645-46340667 CCCAGCCAGGAGTCCCCTGAAGG - Exonic
907279309 1:53335217-53335239 CCAACCCAACTGTCCCTTGATGG - Intergenic
908174121 1:61537644-61537666 CCAACCCAGGAGTGACCTTTAGG - Intergenic
908445701 1:64197438-64197460 AGAACCCAGGTCTGCCTTGAAGG + Intergenic
911039074 1:93578196-93578218 CGGACCCAGGAGAGCCCTGATGG + Intronic
917615865 1:176743567-176743589 CCATCCCAGGATTGTGTTGATGG + Intronic
917676391 1:177322857-177322879 CCATCCCAGGATTCCTTTGATGG - Intergenic
918393338 1:184089298-184089320 ACAACCCAGAAGAGCATTGACGG - Intergenic
921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG + Intronic
923656540 1:235921981-235922003 CCCACCCAGTAGTTCCATGACGG + Intergenic
1064136374 10:12754233-12754255 CCATCCCAGGAGTCCCTTCTGGG + Intronic
1065864753 10:29904686-29904708 CCAACTCAGGACATCCTTGAAGG + Intergenic
1066454193 10:35559011-35559033 AAAACCCAAGACTGCCTTGAAGG + Intronic
1070451687 10:76564682-76564704 CAAACAAAGGGGTGCCTTGAGGG + Intergenic
1070723557 10:78773050-78773072 CCATCCCAGGAGTGCCAGCAAGG + Intergenic
1076006163 10:126949319-126949341 CCAACCAAGAAGTGCCTTCCTGG - Intronic
1077860090 11:6170260-6170282 CCAACCCAGGGATGCCAGGAAGG + Exonic
1078491591 11:11774307-11774329 CCAAACCAGGAGTGACTGAAGGG + Intergenic
1078987089 11:16607173-16607195 CTAACCCTGGAGTGCCCGGAAGG + Intronic
1079094075 11:17499893-17499915 CCAGCCTAGGACTGCCTGGAAGG + Intronic
1080637170 11:34134310-34134332 CCCCCACAGGTGTGCCTTGAAGG + Exonic
1083663836 11:64264277-64264299 CCAGCCCAGGTGTGACCTGAAGG - Intronic
1083808546 11:65089204-65089226 CCAACACAGGAGTGCCTCACGGG + Intronic
1084570614 11:69957436-69957458 GCAACCCAAGTGTGCATTGATGG - Intergenic
1084587601 11:70072127-70072149 CCAAACCCAGAGGGCCTTGAAGG + Intergenic
1086049787 11:82576965-82576987 CCCACCCAGGAGTGGCCTGGAGG + Intergenic
1089139963 11:116276903-116276925 CAAACTCAGCAGTGCCTAGAAGG - Intergenic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1090798694 11:130157098-130157120 CCAACCCAGGAGTGCACATAGGG + Intergenic
1091773761 12:3170825-3170847 CCAACCCAGGAGTCCCTGCCCGG - Intronic
1096210593 12:49762622-49762644 CCACCCCAGGAGTGCCGAGGTGG - Intronic
1096648155 12:53049227-53049249 CAGACCCAGGAGAGCCATGAAGG + Exonic
1098887008 12:75970374-75970396 CTAAGCCAGGAGTGATTTGAAGG + Intergenic
1100788018 12:98099552-98099574 CCAACTCAGGAGGGACTAGAAGG - Intergenic
1102518629 12:113465830-113465852 CCAACCCTGGAGAGCCCGGATGG - Intronic
1103246033 12:119458319-119458341 TAAAGCCAGGAGTGCTTTGACGG - Intronic
1107108428 13:36671718-36671740 CCAATCCAAGTGTGCCTGGAAGG + Intergenic
1109074764 13:57821100-57821122 TCAAGCCAGGAGTGGCTTGATGG - Intergenic
1114595599 14:23909213-23909235 CCAACTCAGGAGAGCTCTGATGG - Intergenic
1114654287 14:24306764-24306786 CCAAACCAGAAGTGACTTGGAGG - Exonic
1116336684 14:43665936-43665958 CCAGCACATGAGTGCCTGGAAGG + Intergenic
1117315430 14:54567203-54567225 CCACCCCAGGCGGGCCGTGAGGG + Intronic
1117902333 14:60548243-60548265 ACAACCCAGGAGTGCAAGGATGG - Intergenic
1118352605 14:64983876-64983898 CCGACCCTGGAGTGCGTTTAGGG - Intronic
1118508791 14:66446837-66446859 ACAAGCCAAGAGTTCCTTGAGGG - Intergenic
1118997108 14:70846593-70846615 CCACACCAGGTGTGCCTTGCAGG - Intergenic
1119732692 14:76961139-76961161 GCACCCCAGGAGTGCCTGTAGGG + Intergenic
1120849270 14:89154876-89154898 CAAACCCAGAAGAGCCTTCATGG + Intronic
1121694019 14:95898057-95898079 CCAACCCAGGAAAGCAATGACGG - Intergenic
1121952926 14:98187672-98187694 CCAACCCAGGAGTCCACTGTGGG + Intergenic
1126820334 15:52496849-52496871 CCAACTCAGGACTACCCTGAAGG - Intronic
1126904176 15:53346761-53346783 ACAACCTGGGAGTTCCTTGAGGG - Intergenic
1128235548 15:66064946-66064968 CCAACCTGGGAGTGTCTGGAAGG + Intronic
1128385226 15:67142908-67142930 CCAACCCAGGAGTGAGCCGACGG - Exonic
1129896564 15:79112610-79112632 CCAACACAGGACAGCCATGAAGG - Intergenic
1131029229 15:89172520-89172542 CCAACCCAAGTGTGCCTTGATGG - Intronic
1131656087 15:94460685-94460707 CCAACCCTGCAGTGCTTTGAGGG + Intronic
1132186952 15:99808430-99808452 ACGACCCAGGAGAGCCTTGATGG - Intergenic
1132373479 15:101313315-101313337 CCAGCAAAGGAGTGCCTGGAGGG - Intronic
1132428735 15:101744291-101744313 ATGACCCAGGAGAGCCTTGATGG + Intronic
1133270591 16:4609313-4609335 CCAGCCCAGGGGTGCCGTGGAGG - Exonic
1139320587 16:66110883-66110905 CCATCACAGGAGGGCCTTGAGGG + Intergenic
1139801545 16:69526925-69526947 CCAATCCAGGCGTGCCAGGAGGG + Intergenic
1139948829 16:70659552-70659574 GCACCCCAGGAGAGCCGTGAGGG - Intronic
1141607518 16:85163208-85163230 GCAACCGAGAAGTGCCGTGAGGG - Intergenic
1141607529 16:85163269-85163291 GCAACCGAGAAGTGCCGTGAGGG - Intergenic
1141607540 16:85163330-85163352 GCAACCGAGAAGTGCCATGAGGG - Intergenic
1141607551 16:85163391-85163413 GCAACCGAGAAGTGCCATGAGGG - Intergenic
1145833933 17:27939488-27939510 TTATTCCAGGAGTGCCTTGATGG - Intergenic
1146095871 17:29929997-29930019 ACAACCCAGCAGCGCCTAGATGG - Exonic
1147300841 17:39526018-39526040 CCAATCCATCAGTGCCCTGACGG + Exonic
1149458900 17:56811400-56811422 CCCACCCAGCTGTGGCTTGAAGG - Intronic
1150263406 17:63815304-63815326 CCCTTCCAGGAGAGCCTTGAGGG + Intronic
1150431820 17:65124405-65124427 CCACCCCAGAAGTGGATTGAGGG - Intergenic
1152201485 17:78949467-78949489 CCAAGGCAGGAGTGCAGTGATGG - Intergenic
1152659293 17:81535006-81535028 CCTACCCAGGAGAGGCGTGAGGG + Intronic
1153459535 18:5318286-5318308 GCAAACCAGGAGGGACTTGAGGG - Intergenic
1156401241 18:36742287-36742309 CTAGCCGTGGAGTGCCTTGAGGG + Intronic
1156500002 18:37551533-37551555 CCAGCACAGGAGTGGCTGGATGG - Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1163812072 19:19439426-19439448 CCAACCCAGAAATGTCTTGGTGG - Intronic
925336169 2:3100832-3100854 CAAGCCCAGGAGGGCCCTGAAGG - Intergenic
926731178 2:16036889-16036911 CCAACTCTGCAGAGCCTTGAAGG + Intergenic
928079927 2:28301821-28301843 CCAAACCATGAGTACTTTGAAGG + Intronic
928235254 2:29533756-29533778 CCAGACCTGGAGTTCCTTGAAGG - Intronic
930002970 2:46873665-46873687 CCAACCCAGAGGAGCCTGGAGGG - Intergenic
935073059 2:99712828-99712850 CCAACCCAAGTGTCCATTGACGG + Intronic
935367389 2:102308740-102308762 CTAACTCAGGAGGACCTTGATGG + Intergenic
938953605 2:136279139-136279161 CCACTCCAAGAGTCCCTTGAGGG + Intergenic
940027322 2:149222135-149222157 CGAAGCCCGCAGTGCCTTGAGGG + Intergenic
944166372 2:196726286-196726308 CCGACAAAGGTGTGCCTTGATGG + Intronic
1171300774 20:24058442-24058464 TCAACCTAAGAGTCCCTTGATGG + Intergenic
1171315889 20:24194392-24194414 CCAACCCAGGCAGGCCCTGAAGG + Intergenic
1172246923 20:33451939-33451961 CCAACCTAAGAGTGCTTTCAGGG + Intergenic
1172509213 20:35488541-35488563 TGAGCCCAGGAGGGCCTTGAGGG - Intronic
1173079564 20:39852732-39852754 GCAACACAGAAGTTCCTTGAAGG + Intergenic
1173616455 20:44406343-44406365 CAAAACCAGAAGAGCCTTGAAGG - Intronic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1175936361 20:62515965-62515987 CGCACCCAGGGCTGCCTTGAGGG - Intergenic
1181882747 22:25994058-25994080 CCAGCCCAGGACTGCATTAAGGG - Intronic
1184072652 22:42155431-42155453 ACAAGCCAGCAGTGCCATGAGGG + Intergenic
1184341060 22:43886210-43886232 CCAGACCACGAGTGCCTTCAAGG + Intronic
950635155 3:14308917-14308939 CTAGACCAGGAGTTCCTTGAGGG - Intergenic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954798750 3:53175022-53175044 CCACCCCAGGACTGCATGGAGGG - Intronic
959829267 3:110840861-110840883 TCTATCCATGAGTGCCTTGAGGG + Intergenic
959987229 3:112587792-112587814 GCAACCCAGGTGTCCATTGATGG - Intergenic
961444687 3:126973734-126973756 CCAGCCCAGGATTGCTGTGATGG + Intergenic
961467311 3:127089735-127089757 CCACCCTGGGAGTTCCTTGAGGG - Intergenic
963132375 3:141870339-141870361 CTAACCCAGGAGTGCAATGTCGG - Intergenic
964541210 3:157781972-157781994 TCAATCCAGAAGTCCCTTGAGGG - Intergenic
964689141 3:159430646-159430668 TCACCCCAGGAGTGTCTAGATGG - Intronic
965079552 3:164019790-164019812 CCAATCAAGGAATGCCATGAGGG + Intergenic
967088644 3:186116203-186116225 CCATCCCAGGAGAGCCCTGAAGG + Intronic
968801124 4:2743887-2743909 CCTACCATGGGGTGCCTTGAGGG - Intronic
969375753 4:6762114-6762136 CCATTCCAGATGTGCCTTGAGGG - Intergenic
970051723 4:11922093-11922115 CCAACACAGGACAGCCCTGAAGG + Intergenic
986022052 5:3813330-3813352 GAAACCCAGGAGTGGCTTTATGG + Intergenic
986684771 5:10267098-10267120 CCAACCTAGGTGTTCCTTGCAGG + Intergenic
987686175 5:21206025-21206047 CCAAGCAAGGGGTGCCTTTATGG - Intergenic
987821277 5:22970053-22970075 GCACCCCAGGAGTGCCAAGATGG - Intergenic
989213543 5:38880746-38880768 CCAACCCACCAGTCCCTTGCAGG - Intronic
993445536 5:88007636-88007658 CCAAACCAGGAGTTCCATGCTGG - Intergenic
994022951 5:95049217-95049239 GAAACCCAGAAGTGCCTTGCTGG - Intronic
995385571 5:111585214-111585236 CAGACACAGGAGTGCCATGAAGG + Intergenic
997750212 5:136337039-136337061 CCAAACTAGTAATGCCTTGAAGG + Intronic
997838766 5:137218974-137218996 ACAACAAAGGAGTGCCTTGGTGG - Intronic
999310996 5:150552115-150552137 CAAGACCAGGAGTTCCTTGAAGG - Intronic
1000390659 5:160719437-160719459 ACAACCCAGTAGTTCCTGGAGGG + Intronic
1000656942 5:163890618-163890640 CCAATCCATCAGTGACTTGAGGG - Intergenic
1001406337 5:171480050-171480072 CTAACCAAAGAATGCCTTGAAGG + Intergenic
1001645395 5:173277961-173277983 CTAACACAGAAGTTCCTTGAGGG - Intergenic
1001696732 5:173675762-173675784 CCTACCCAGGACTGCCTGGCAGG + Intergenic
1007192910 6:40035103-40035125 CTAACCCAAGATTGACTTGAAGG + Intergenic
1007809637 6:44476820-44476842 GCAGCCCAGGAGTCCCTTGAGGG + Intergenic
1011706104 6:90003036-90003058 GCAACCCAGGTGTGACCTGATGG - Intronic
1012047975 6:94302615-94302637 CCAACCTAGGTGTGCATTGATGG + Intergenic
1012453473 6:99378826-99378848 CCAACCAGGAAGTTCCTTGAGGG + Intronic
1013832623 6:114292658-114292680 CCAAACCATGAGTAACTTGAGGG - Intronic
1014250512 6:119111116-119111138 GCAACCCAAGTGTCCCTTGATGG + Intronic
1017277048 6:152581705-152581727 CCAGCCCAAGAATGCCTTGGGGG + Intronic
1017651817 6:156590538-156590560 CCAATCCAGGAATCCCTTGCTGG - Intergenic
1018473083 6:164113568-164113590 CCAACACAGCATTGCCTGGAGGG - Intergenic
1022409096 7:30122640-30122662 CAAACTCAGGAGTCCCTTCATGG - Intronic
1022772930 7:33493784-33493806 CCATCCCATGAGTGTCTTGCTGG + Intronic
1023240638 7:38143022-38143044 CCAACCCAAGTGTTCATTGAAGG + Intergenic
1024918936 7:54536386-54536408 CCAACCTAGGATTTCCATGATGG + Intergenic
1025962630 7:66237048-66237070 CCAACCCAGAAGTGGCATGCAGG - Intronic
1027233824 7:76286484-76286506 CTGACCCAGGAGTGCCCAGACGG + Exonic
1029580491 7:101433836-101433858 CCAACCCAGGAGTGCCTTGAAGG + Intronic
1032837757 7:135689755-135689777 CCAAGCCAGAAGTGCCATGGAGG + Intronic
1033456986 7:141511753-141511775 CCGACCCAGGAATGCCTGGCGGG - Intergenic
1036708214 8:11060418-11060440 GCAGCCCCGCAGTGCCTTGATGG + Intronic
1037145955 8:15573255-15573277 GCCTCCCAGGAGTGACTTGATGG - Intronic
1037799293 8:22023885-22023907 ACAACCCAGGAGAGGCTTGGGGG - Intergenic
1039241147 8:35558157-35558179 CCAACCCAGAAGCTCCTTGAGGG + Intronic
1040341230 8:46442184-46442206 CCTACCCAGTAGTGCCCTGGGGG + Intergenic
1040588923 8:48771101-48771123 CCTACACAAGAGTTCCTTGATGG + Intergenic
1042733359 8:71961592-71961614 CTGCCCCAAGAGTGCCTTGAGGG + Intronic
1042866022 8:73357386-73357408 CCAAACCAGGATTTCCTTCAGGG - Intergenic
1047551956 8:125883751-125883773 GCAAACCAGGAGTGCTTTGATGG - Intergenic
1049445326 8:142627835-142627857 CCAGCCCGGGAGCACCTTGAGGG + Intergenic
1049600712 8:143506115-143506137 CCTGCCCAGGAGGGCCCTGATGG - Intronic
1050077154 9:1877221-1877243 CAAACCCAGGATTTCCATGAAGG + Intergenic
1051382809 9:16476032-16476054 CCTACCCAGGACAGCCTAGAGGG + Intronic
1053172318 9:35897527-35897549 GCAACACAGGAGTACCTTGGAGG + Intergenic
1056806952 9:89736403-89736425 ACAACCGAGGACTGCCTTAATGG + Intergenic
1058812348 9:108653090-108653112 TCAGACCAGGAGTCCCTTGAGGG - Intergenic
1061411120 9:130422277-130422299 CCAACTCAGGTGTGGCTTGGGGG + Intronic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1062644511 9:137540599-137540621 CCAACCCAGGGGCGCCCGGAGGG + Intronic
1187675724 X:21714526-21714548 CCAACCCAGTTGTGTCTTGATGG - Intronic
1190746227 X:53323427-53323449 ACAACCCAGGAGTTCCCTCAGGG + Intergenic
1193198125 X:78657786-78657808 GCAGCCCAGGAGTCCCTGGAGGG - Exonic
1196835178 X:119807352-119807374 GCAATCCAGAAGTGCCTTCAGGG - Intergenic