ID: 1029588804

View in Genome Browser
Species Human (GRCh38)
Location 7:101493324-101493346
Sequence CCTGCCAGGCAAACACTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029588804_1029588808 -3 Left 1029588804 7:101493324-101493346 CCCTTCAGTGTTTGCCTGGCAGG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1029588808 7:101493344-101493366 AGGCTCTAGTCCATCTGCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029588804 Original CRISPR CCTGCCAGGCAAACACTGAA GGG (reversed) Intronic
901817651 1:11804010-11804032 CCTGCAAGGCAAGCACAGATGGG - Intronic
902584812 1:17432262-17432284 CCTGCCAGTTAAACAAAGAAGGG - Intronic
902968896 1:20032470-20032492 CCTGCCAGGGCAAGACTGACTGG - Intronic
904301647 1:29558168-29558190 CCTGCAAGGCGCACCCTGAAAGG - Intergenic
904866332 1:33581915-33581937 ACTGCCATGCAAACTGTGAAGGG + Intronic
904926522 1:34053333-34053355 CCTGTCTGGGAAAGACTGAAAGG + Intronic
904969190 1:34405777-34405799 TCTACCAGTCAAACCCTGAAAGG + Intergenic
905106787 1:35568057-35568079 CTTGCCAGGCAGACACGAAAAGG + Intergenic
907280683 1:53345142-53345164 CCTGCCAGGCAACCACCCACTGG - Intergenic
907344495 1:53763525-53763547 CCTGGCAGAGAAACACTGGAAGG - Intergenic
911251681 1:95583748-95583770 CCTGCCTGGAATAGACTGAAAGG + Intergenic
913177281 1:116286410-116286432 ACTGCCAGAAAAACACTGTAAGG - Intergenic
914982351 1:152425879-152425901 CCTTCCAGGGCAACACTGAGAGG + Intergenic
917121177 1:171645889-171645911 CCTGCAAGGCACAATCTGAAGGG - Intronic
918478945 1:184956369-184956391 CAGGCCATCCAAACACTGAATGG + Intronic
919320613 1:196032247-196032269 TCTTCCAGGCAAAAAATGAATGG + Intergenic
919619558 1:199849594-199849616 CCTACCTGGCACCCACTGAATGG + Intergenic
920135022 1:203762699-203762721 CCTTTCTGGCAACCACTGAAGGG + Intergenic
920198019 1:204242457-204242479 CTCACCAGGCAAACACTCAAGGG + Intronic
923435086 1:233960497-233960519 TCTGCCAGGCGAACAGAGAAAGG - Intronic
1062964977 10:1600220-1600242 CATCCCAGGCAAACACCTAATGG - Intronic
1064746967 10:18487908-18487930 CCTGCACAGGAAACACTGAAAGG + Intronic
1067838471 10:49656568-49656590 CTTGTCAGGCAGACACAGAAGGG + Intronic
1068819229 10:61353732-61353754 CCTGGGAGGCAAACAGAGAAAGG - Intergenic
1069555508 10:69395139-69395161 CCAGCCAGGCGACCTCTGAAGGG - Intronic
1069716184 10:70522926-70522948 CCTGCTGGCCACACACTGAAGGG - Intronic
1071060998 10:81570810-81570832 CCTGGCATGCAAACTCAGAAGGG + Intergenic
1072249030 10:93567295-93567317 CCTGCCCGGCACACACAGAGGGG - Intronic
1076273246 10:129174812-129174834 CCTGCCAGGCAGTTAATGAAAGG - Intergenic
1076286623 10:129305383-129305405 TATGGCAGACAAACACTGAAAGG + Intergenic
1078733107 11:13993748-13993770 GCTGCCAGGGATACTCTGAAGGG - Intronic
1078735040 11:14012030-14012052 CCTGGCAGGTAAACAGTGGATGG + Intronic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079131198 11:17747816-17747838 GCTGCCAGGCCAACAGGGAAGGG - Intronic
1082894557 11:58176296-58176318 CCTGCCATGCACCCACTGAGTGG - Intronic
1084378662 11:68796671-68796693 GCTACTAGGCTAACACTGAAGGG + Intronic
1084968917 11:72758862-72758884 CCAGCCAGGCCAACAATGTAAGG - Intronic
1085843017 11:80035346-80035368 TTTGCCAGGCAAACATTCAATGG + Intergenic
1087581558 11:100061824-100061846 ATTGCCAGGCAAAAACTGACAGG - Intronic
1088745334 11:112799993-112800015 CATACCAGGCATACACTAAATGG - Intergenic
1089252573 11:117175523-117175545 CCATCCAAGCAAACTCTGAAGGG - Intronic
1090466463 11:126939035-126939057 CCTGCCAGGCACACATAGTACGG + Intronic
1092018483 12:5180153-5180175 CCTGGCAGGCAATAACTGTAAGG + Intergenic
1092128172 12:6089854-6089876 TCTGCCTGGAGAACACTGAAGGG + Intronic
1093565894 12:20603253-20603275 CCTGGGAGGCAAACACAGCATGG - Intronic
1096527131 12:52217011-52217033 CCTGCTGGGGAAACAGTGAAGGG + Intergenic
1100667150 12:96767582-96767604 CCTGCCAGGAAAGGACTGGAAGG - Intronic
1104796116 12:131520477-131520499 ACAGCCAACCAAACACTGAATGG + Intergenic
1107875929 13:44790251-44790273 CCTGCCCTGCCAACTCTGAAGGG + Intergenic
1111878750 13:93929152-93929174 CCTGAAAGGCAAGCAGTGAAAGG - Intronic
1112829862 13:103436391-103436413 TCTCCCAGGCAGACACAGAAGGG - Intergenic
1113355991 13:109580686-109580708 CCTGGCAGGCAAACACCCAGAGG - Intergenic
1119834034 14:77731287-77731309 CCTGCCTGGAAGACACTGCAAGG + Intronic
1121122958 14:91387727-91387749 CCTGACAGGGAAACAAGGAAAGG + Intronic
1121999455 14:98634850-98634872 CCTGCCACTTACACACTGAAAGG + Intergenic
1124627953 15:31320143-31320165 CCAGTTAGTCAAACACTGAAGGG - Intergenic
1125034666 15:35110417-35110439 CCTGAAAGGCAAACAAAGAAAGG - Intergenic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1125853196 15:42923718-42923740 CTTGCCAGGGGAACACTGCATGG - Intergenic
1128300963 15:66566022-66566044 CCTGCCCGGCCCCCACTGAATGG - Intergenic
1130344824 15:83033182-83033204 CCAGCCAGGGAAACACAGCAGGG + Intronic
1131488059 15:92838520-92838542 TTTGGCAGGAAAACACTGAAGGG - Intergenic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1136995017 16:35183191-35183213 CCTGTCACGCACACACTGAAGGG + Intergenic
1137955854 16:52828237-52828259 GGTGCCAGGCAGACAATGAAGGG - Intergenic
1139682524 16:68576149-68576171 ACAGCCAGGCAACCACTGGAAGG + Intergenic
1143337070 17:6179331-6179353 TCTGCTGGTCAAACACTGAAAGG + Intergenic
1143351496 17:6291390-6291412 GCTGCCAGGCCAACCCTGAGAGG - Intergenic
1144320589 17:14115068-14115090 CCTGACAGGCACTCAGTGAATGG + Intronic
1146713650 17:35064990-35065012 TCTGAAAGGAAAACACTGAAGGG - Intronic
1148442537 17:47719132-47719154 CCTGCCAGGCACACATGTAATGG + Intergenic
1149316327 17:55442365-55442387 CCTGCCATTCAAAGTCTGAATGG + Intergenic
1151086816 17:71389714-71389736 CCTTCCAGGGAACCACTCAAGGG - Intergenic
1151626387 17:75278450-75278472 CCTGCCAGGAAGACAGTCAAGGG + Intronic
1153805401 18:8705655-8705677 CCGGCCATGGAGACACTGAACGG + Intronic
1153886745 18:9474773-9474795 ACTGCCAGCCAAACACGGACTGG + Intergenic
1154955767 18:21253105-21253127 CCTGAGAGGAAAACACTGCAGGG + Intronic
1155368859 18:25077210-25077232 CCTACACAGCAAACACTGAAGGG + Intronic
1156787606 18:40934386-40934408 CCAGTCAGGAAACCACTGAAAGG - Intergenic
1157774284 18:50379470-50379492 CCTTCCACACACACACTGAAGGG + Intronic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1159946100 18:74445892-74445914 CCAGCTAGGCGAACACTGATGGG - Intronic
1160239206 18:77111106-77111128 CCTCCCAGGCAAACATTGCCAGG - Intronic
1161100227 19:2418131-2418153 CCTGCCAGGTAAGCATTCAAAGG + Exonic
1162647412 19:12059864-12059886 CCAGACAGGCAAACCCAGAAAGG - Intergenic
1168126869 19:54289047-54289069 CATGTCAGGCAGACAGTGAAAGG - Intergenic
1168394320 19:56035309-56035331 GCTGCCAGGCAAACACCACATGG - Intronic
927247157 2:20966508-20966530 CCCACAAGGCCAACACTGAAGGG + Intergenic
927639952 2:24840031-24840053 CCTGCCAGGTACACACAGAAAGG + Exonic
929071865 2:38038937-38038959 CCTGGCAGCCAAACAGGGAAGGG + Intronic
930611895 2:53553750-53553772 CCTGCCCTGCCAACTCTGAAGGG - Intronic
935930387 2:108117876-108117898 ACTGGCAGGCTAACACAGAAAGG + Intergenic
936519428 2:113202319-113202341 CCTGCCAGGCAGACCCCTAAGGG - Exonic
942078817 2:172381588-172381610 CCTGACAGGCAAACACTCATAGG - Intergenic
942657606 2:178230308-178230330 CCTGACAGGAAAAAACAGAATGG + Intronic
942951636 2:181728621-181728643 GCTGCCAGCCAAAGACTGAGTGG - Intergenic
945159350 2:206873146-206873168 CGTGCCTGGCAAACACTACAAGG - Intergenic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
945408029 2:209473661-209473683 CCTGCCAGGCAAAAAGTTACAGG + Intronic
946140579 2:217687262-217687284 CCCTACATGCAAACACTGAAAGG + Intronic
946630178 2:221658556-221658578 CCTTCTAGGCCAACATTGAAGGG - Intergenic
1169952434 20:11060286-11060308 CCTGCCACACTAAAACTGAATGG - Intergenic
1171070802 20:22066606-22066628 TCTGCCAGGGAAGCACAGAATGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172455123 20:35065244-35065266 CCTCTCAGGGAAACACTCAATGG + Intronic
1172559244 20:35871351-35871373 ACCTCCAGGCCAACACTGAACGG - Intronic
1173168280 20:40701461-40701483 TATGCCAGGCAAGCCCTGAATGG + Intergenic
1173243151 20:41316089-41316111 CATGACAGGCAAACATTGCATGG - Intronic
1174367380 20:50064708-50064730 CCTCCCAGGCACACACAGAGGGG + Intergenic
1174716156 20:52761163-52761185 CCTGCCATTCCAACACAGAATGG - Intergenic
1176181386 20:63751458-63751480 CCGGCCAGGCAAACACGGGGAGG + Intronic
1182712039 22:32329196-32329218 TCTGCCAGGTGCACACTGAATGG - Intergenic
1183663795 22:39235874-39235896 CCTGCCGGGCAGACACCAAAAGG + Exonic
1184399584 22:44266070-44266092 TCTGCCAGGTGCACACTGAATGG - Intronic
951066037 3:18266629-18266651 CCTGCAAGGCAGACTCTAAATGG + Intronic
951645616 3:24887728-24887750 ACTGAAAGGCAAATACTGAAAGG - Intergenic
952899408 3:38099731-38099753 CATGCCAGGCACACACACAAAGG - Intronic
954416325 3:50395231-50395253 CATGCCAGGCACACTGTGAATGG - Intronic
954729888 3:52651217-52651239 ACTGCCAGGGATACAGTGAAGGG + Intronic
956018398 3:64908454-64908476 CCTGGGAGGCAAACAAAGAAAGG + Intergenic
958885106 3:99717325-99717347 CCTGCCAAGCATAGGCTGAAAGG - Intronic
959619928 3:108388934-108388956 CCAGCCAGACAAACAGGGAATGG + Intronic
961613103 3:128156273-128156295 CTTACCAGGCAAACCCTGCAAGG + Intronic
962373346 3:134839630-134839652 CCTGCCAGGCTGACTCTGACTGG + Intronic
968568121 4:1325727-1325749 CCTGCCAGGCTGGCTCTGAAGGG + Intronic
971069025 4:23069527-23069549 CCTGCCTGGAAAACAATGCAAGG - Intergenic
972931346 4:44075221-44075243 CCTTTCTGGCAAACAGTGAAAGG + Intergenic
974312837 4:60234388-60234410 GCTGCCAGGCAACCAAAGAATGG + Intergenic
976699993 4:87959630-87959652 TCTTCCTGGCAAACCCTGAAGGG + Intergenic
977465172 4:97374798-97374820 CATTCCAGGCAAACAATGCAAGG + Intronic
978498341 4:109384044-109384066 CCTGCCCTGCCAACACAGAAGGG - Intergenic
978686731 4:111454325-111454347 CATTCCAGCCAAACCCTGAAGGG - Intergenic
982164813 4:152604872-152604894 CCTGCCAGGCAAACAGCCCATGG + Intergenic
986412635 5:7495984-7496006 TCTCCTAGGCAAGCACTGAAGGG + Intronic
986495442 5:8337295-8337317 TCTTCCAGGCAAACATGGAAAGG + Intergenic
989743009 5:44793991-44794013 CCTTTCTGGCAAACCCTGAAGGG - Intergenic
992332059 5:75727713-75727735 CCTGCAAGGTAGAAACTGAAAGG - Intergenic
993581167 5:89662663-89662685 CCTGCCAGGCAAACAGCCAGAGG - Intergenic
994062489 5:95495922-95495944 CTTACCAGGCCAAAACTGAAAGG + Intronic
995146180 5:108788628-108788650 CCTGGCAGTCCAAGACTGAAAGG - Intronic
996797866 5:127369958-127369980 CCAGCCAGGCTCACACTGACAGG - Exonic
998151007 5:139757490-139757512 TCTGCCAGGCAGTCCCTGAAGGG + Intergenic
1000966408 5:167662321-167662343 CATGCCAGGCAAACGAGGAAGGG - Intronic
1001421774 5:171593036-171593058 CCTGCCAAGCACACATTGCAAGG - Intergenic
1002955646 6:1860838-1860860 CATGGCAGGCACACACTGATGGG + Intronic
1003380964 6:5624399-5624421 CCTGCCAGGACAGCACTGAAGGG - Intronic
1011340447 6:86307685-86307707 CCTGCCAGGGAACCCCAGAATGG + Intergenic
1014048051 6:116916830-116916852 CCTTCTAGGCAAACATTTAATGG + Intronic
1016684594 6:146866984-146867006 CCTCCCTGGCTAACACTCAAAGG + Intergenic
1019173530 6:170148135-170148157 AGCGCCAGCCAAACACTGAAGGG - Intergenic
1020830545 7:13089504-13089526 CCTGCCAGGCAGAAAGTGAAGGG + Intergenic
1023709194 7:42973985-42974007 TGTGCCAGGCAAACCCAGAAAGG + Intergenic
1027361317 7:77413372-77413394 CTTGGCAGGCAATCCCTGAAGGG + Intronic
1027798803 7:82725879-82725901 CTTGCTGGGCAAACACAGAAAGG + Intergenic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1032845087 7:135745418-135745440 CCTGCCAGGGCACCACTGGAAGG - Intronic
1033577975 7:142704426-142704448 TCTTCCTGGCAAACCCTGAAGGG + Intergenic
1035739270 8:1913957-1913979 ACTTCCAGGCAAACGCGGAAAGG + Intronic
1035844538 8:2848601-2848623 CTTGCCAGGCAAAAACTGAAGGG - Intergenic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1048861042 8:138724654-138724676 CTCTCCAGGCAAACCCTGAAAGG + Exonic
1052343385 9:27384691-27384713 CATGCCAGGGAAATACTGGAGGG - Intronic
1052891457 9:33704252-33704274 TCTTCCTGGCAAACCCTGAAGGG + Intergenic
1058599717 9:106656212-106656234 TCTGGCAGGAAAACACTGGACGG - Intergenic
1060798170 9:126526629-126526651 CCTGGCCGGCAGACATTGAACGG - Intergenic
1061588373 9:131583056-131583078 CTTCCCAGGCACACACTGAGTGG + Intronic
1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG + Intronic
1194578292 X:95640501-95640523 CCTGCCAAGCAAACATGCAAAGG + Intergenic
1195331996 X:103810198-103810220 CCAGCTAGGCAAATAGTGAAGGG + Intergenic
1198710331 X:139494896-139494918 ACCGCCAGGCACACACTTAAGGG + Intergenic
1202152963 Y:21859678-21859700 CCTGCAAGGCCAACGATGAAGGG - Intergenic