ID: 1029594448

View in Genome Browser
Species Human (GRCh38)
Location 7:101529639-101529661
Sequence CTTGTTCAGCTCCTACTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 1, 2: 26, 3: 109, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029594440_1029594448 10 Left 1029594440 7:101529606-101529628 CCTCATACCCCATCTTTATGTCC 0: 1
1: 0
2: 0
3: 22
4: 196
Right 1029594448 7:101529639-101529661 CTTGTTCAGCTCCTACTTATAGG 0: 1
1: 1
2: 26
3: 109
4: 327
1029594441_1029594448 3 Left 1029594441 7:101529613-101529635 CCCCATCTTTATGTCCATATATA 0: 1
1: 6
2: 20
3: 86
4: 747
Right 1029594448 7:101529639-101529661 CTTGTTCAGCTCCTACTTATAGG 0: 1
1: 1
2: 26
3: 109
4: 327
1029594442_1029594448 2 Left 1029594442 7:101529614-101529636 CCCATCTTTATGTCCATATATAC 0: 2
1: 49
2: 380
3: 891
4: 2020
Right 1029594448 7:101529639-101529661 CTTGTTCAGCTCCTACTTATAGG 0: 1
1: 1
2: 26
3: 109
4: 327
1029594443_1029594448 1 Left 1029594443 7:101529615-101529637 CCATCTTTATGTCCATATATACC 0: 3
1: 85
2: 508
3: 1382
4: 2552
Right 1029594448 7:101529639-101529661 CTTGTTCAGCTCCTACTTATAGG 0: 1
1: 1
2: 26
3: 109
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029594448 Original CRISPR CTTGTTCAGCTCCTACTTAT AGG Intronic
900722787 1:4188462-4188484 ATTGTTTAGCTCCCACTTATTGG + Intergenic
901509232 1:9707573-9707595 CTTATTTAGCTCCCACTTATAGG + Intronic
902303278 1:15518293-15518315 TTTGTTCATCTCCTGCTTAGAGG - Exonic
905907675 1:41630203-41630225 AATGTTTAGCTCCTGCTTATAGG - Intronic
906148324 1:43573036-43573058 CCTGTCCAGCTCCTACTTGGGGG - Intronic
906188450 1:43879908-43879930 CTTTTCCTGCTCCTACTTCTGGG + Intronic
906449661 1:45934133-45934155 AGTGTTTAGCTCCCACTTATAGG + Intronic
907968137 1:59353931-59353953 CTTGTTCTGCTCTTACTGCTTGG - Intronic
908090213 1:60677803-60677825 GTTGTTCAGCCCTTACTGATGGG + Intergenic
909512980 1:76475912-76475934 ATTGTTCAACTCCCACTTATAGG + Intronic
910889906 1:92007451-92007473 ATCATTCAGCTCCCACTTATAGG + Intronic
911791970 1:102028997-102029019 ATTGTTCAACTCTCACTTATGGG - Intergenic
911800884 1:102136067-102136089 ATTGATTAGCTCCCACTTATAGG - Intergenic
913719841 1:121581387-121581409 ATTGTTCAGTTCCCACTTATGGG + Intergenic
915391484 1:155548094-155548116 ATTGTTCAACTCCCACTTATGGG - Intronic
916612125 1:166402498-166402520 ATTGTTCGGTTCCCACTTATGGG + Intergenic
917963162 1:180160836-180160858 GTTGTTCAGCTTCTGTTTATAGG + Intronic
918281927 1:183015202-183015224 ATTGTTTAGCTCCCACTTATAGG + Intergenic
918609213 1:186467211-186467233 CTTTTTTAGTTCCTATTTATGGG - Intergenic
918834612 1:189445395-189445417 ATTGTTCAGCTCCCATTTATAGG + Intergenic
919584565 1:199420135-199420157 ATTGTTTAGCTTCCACTTATAGG - Intergenic
920063097 1:203241800-203241822 ATCATTCAGCTCCCACTTATAGG + Intronic
920603004 1:207347795-207347817 ATTGTTTAGTTCCCACTTATAGG + Intronic
920892111 1:209998157-209998179 CTTTTTCAGCTACTCATTATTGG - Intronic
920992621 1:210954118-210954140 ATTGTTCAGTTCCCACCTATGGG + Intronic
921446263 1:215250426-215250448 ATTGTTCAATTCCTACCTATGGG + Intergenic
922055174 1:222035706-222035728 CATGTGCAGGTCCAACTTATGGG - Intergenic
922409711 1:225360061-225360083 ATTGCTCAGTTCCCACTTATAGG + Intronic
923062262 1:230486949-230486971 CTTCTTCAGCTATTACTTCTTGG - Intergenic
924160161 1:241222877-241222899 ATTGTTTAACTCCCACTTATGGG + Intronic
924160288 1:241224309-241224331 ATTGTTCAACTCCCACTTATGGG + Intronic
1063859448 10:10291823-10291845 ATTGTTTAACTCCCACTTATGGG - Intergenic
1063983970 10:11481183-11481205 ATTTTTCAGCACCTACTAATAGG - Intronic
1064540856 10:16403641-16403663 TTTGTTCTTCTCATACTTATTGG - Intergenic
1064564173 10:16623248-16623270 AATGTTTAGCTCCCACTTATAGG + Intronic
1064792099 10:18969507-18969529 CTTGTCAAGATCCTACTTATTGG + Intergenic
1068227142 10:54119985-54120007 ATTGTTCAACTCCTACTTAAAGG + Intronic
1068462493 10:57345685-57345707 ATCATTTAGCTCCTACTTATAGG + Intergenic
1069543523 10:69313196-69313218 CATTTTCAGCTCCTAATAATGGG - Intronic
1070754597 10:78984237-78984259 CTGGTGCAGGTCCTACTTACTGG - Intergenic
1071357644 10:84813759-84813781 AATGTTCAGCTCCCACTTATAGG + Intergenic
1071951337 10:90705955-90705977 ATTGTTCAACTTCTACTTATGGG - Intergenic
1071991716 10:91105999-91106021 ATTGTTCAGCTCCCACTTATAGG + Intergenic
1072262762 10:93696882-93696904 ATTGTTCAGCTCCCATTTATGGG - Intronic
1072497746 10:95979368-95979390 CTGGTTCAGTTCCTCATTATGGG + Intronic
1074190113 10:111128363-111128385 CTTGTGCAGCTGGTACTTAGAGG + Intergenic
1074682594 10:115923471-115923493 ACTGTTCAACTCCCACTTATGGG + Intronic
1075939652 10:126379469-126379491 ATTGTTCAACTCCCACTTATGGG - Intronic
1076184031 10:128432605-128432627 CTGGTTCAGCTCCTTCCCATGGG - Intergenic
1077742978 11:4868172-4868194 ATCATTCAGCTCCCACTTATAGG - Intronic
1078040690 11:7860077-7860099 ATTGTTCAACTCCCATTTATGGG - Intergenic
1079680819 11:23295452-23295474 CTAGTTCAGCTCCTTTTTACTGG - Intergenic
1079977962 11:27116249-27116271 ATTGTTCAACTCCCACTTATAGG - Intronic
1079980516 11:27146850-27146872 ATTGTTCAACTCCCACTTATAGG - Intergenic
1080079962 11:28205319-28205341 CTTGTTCAATTCCCACCTATGGG + Intronic
1080454497 11:32406111-32406133 CTTCTTCAGCTTCTACTTGGAGG + Intronic
1080997782 11:37625357-37625379 AATGTTCTTCTCCTACTTATTGG - Intergenic
1081157576 11:39714578-39714600 ATTGTTCAACTTCCACTTATGGG - Intergenic
1081504096 11:43696939-43696961 ATTGTTCAACTCTCACTTATGGG - Intronic
1081718906 11:45272123-45272145 ATTGTTCAACTTCCACTTATGGG - Intronic
1083078769 11:60068916-60068938 ATTGTTCAGTTCCCACCTATGGG + Intronic
1084382748 11:68823910-68823932 ATTGTTTAGCTGCCACTTATAGG - Intronic
1084578895 11:70009985-70010007 ATAGTTTAGCTCCCACTTATAGG + Intergenic
1084585116 11:70055745-70055767 CTTTTTCACCTCCGACTTTTCGG + Intergenic
1085847901 11:80086733-80086755 CTTGGTGAGCTCTTACTTCTGGG + Intergenic
1086137930 11:83461536-83461558 CTTGTTCAGGTGCTGCTGATAGG + Intronic
1086235175 11:84621681-84621703 GTTGGTCAGTTCCTACTAATGGG + Intronic
1086328786 11:85732520-85732542 ATTGTTGAACTCCCACTTATGGG - Intronic
1087543094 11:99545995-99546017 CTTTTTCATTTCCTACTGATAGG - Intronic
1090737037 11:129618986-129619008 CTTCTTCAGCTCCTCCCTTTGGG + Intergenic
1091109151 11:132949351-132949373 ATTGTTCAGCTGCTTCTTACAGG - Intronic
1091703264 12:2677797-2677819 CTTGTCCAGCTCCTCCTCAGCGG - Exonic
1092644736 12:10558026-10558048 CTTGTTAAGCTGCTGATTATTGG - Intergenic
1093004978 12:14041695-14041717 ATTGTTCAACTCCCATTTATGGG - Intergenic
1094254594 12:28408197-28408219 ATTGTTCAACTCCCATTTATGGG + Intronic
1094816200 12:34187309-34187331 CATGTTTAGATCCCACTTATAGG + Intergenic
1095562505 12:43582985-43583007 ATTGTTCGACTCCCACTTATGGG - Intergenic
1095603294 12:44038256-44038278 CTTGGTGAGCTCCTAGGTATAGG - Intronic
1095628047 12:44341333-44341355 ATTGTTTAGCTCCCTCTTATGGG + Intronic
1096928941 12:55182793-55182815 ATTATTCAGCTCCCACTTATAGG - Intergenic
1097355869 12:58601252-58601274 CTTGTTCAGTTCTTACTTATGGG + Intronic
1097639404 12:62161475-62161497 ATTGTTTAGCTCCCACTTATGGG - Intronic
1098641615 12:72845302-72845324 ATTGTTCAGCTCCCACTTATAGG - Intergenic
1098755589 12:74359145-74359167 ATTGTTTAGCTCCCAATTATGGG - Intergenic
1099082554 12:78203985-78204007 CTATATCAGCTCTTACTTATTGG + Intronic
1099665885 12:85628633-85628655 ATTGTTCAACTCCCACTTATGGG + Intergenic
1100129501 12:91474120-91474142 ATTGTTCAACTCCCACTCATGGG - Intergenic
1100402162 12:94241576-94241598 CTTTCTCAGCTCCCACATATGGG + Intronic
1100761248 12:97810138-97810160 ATTGTTCAACTCCCACTTATGGG - Intergenic
1100964251 12:99995522-99995544 GTTGTTCAACTCCCACCTATGGG - Intergenic
1102404013 12:112656635-112656657 ATCGTTTAGCTCCCACTTATTGG + Intronic
1103585638 12:121952539-121952561 CTGGTTCACCTCCCTCTTATTGG - Intronic
1104551421 12:129760874-129760896 ATTGTTCAACTCCCACTTATGGG + Intronic
1105737071 13:23282545-23282567 ATCGTTTAGCTCCCACTTATAGG + Intronic
1106963046 13:35024039-35024061 CATGTTTAGCTCCCACTTACAGG + Intronic
1109036482 13:57268331-57268353 AATGTTTAGCTCCTACTTATAGG + Intergenic
1109646586 13:65265747-65265769 AGTGTTTAGCTCCCACTTATAGG - Intergenic
1110540565 13:76702364-76702386 ATTGTTCAACTCCTACTTTGCGG - Intergenic
1110822669 13:79934706-79934728 ATTGTTCTACTCCCACTTATGGG - Intergenic
1111320445 13:86621048-86621070 AATGTTCAACTCCCACTTATGGG - Intergenic
1111364561 13:87224768-87224790 ATTGTTCAGCTCCCACTTATGGG + Intergenic
1111398809 13:87704838-87704860 GATGCTCAGTTCCTACTTATTGG - Intergenic
1111466003 13:88611513-88611535 ATTGTTCAACTCCCACTTATGGG + Intergenic
1111598287 13:90438597-90438619 CTTTATCAGCTCCTAATCATGGG + Intergenic
1112458798 13:99584928-99584950 AATGTTTAGCTCCCACTTATGGG - Intergenic
1112529596 13:100187964-100187986 GTAGCTTAGCTCCTACTTATGGG + Intronic
1114147690 14:19995868-19995890 AATGTTTAGCTCCTATTTATAGG - Intergenic
1114283004 14:21211880-21211902 CTGGGTCAGCTCCTTCTTAATGG + Exonic
1114943112 14:27641144-27641166 ATTGTTCAACTCCCACTTATGGG + Intergenic
1114960298 14:27879091-27879113 ATTGTTCAGCTCCCACTTATGGG + Intergenic
1115778677 14:36745056-36745078 ATTGTTCAACTCCCACTTATGGG + Intronic
1115951524 14:38727306-38727328 CTTGTTCCGCTCCTTCTCCTGGG - Intergenic
1115973856 14:38975404-38975426 ATTGTTCAACTCCCACTTATGGG + Intergenic
1116641593 14:47470328-47470350 ATTGTTCAACTCTCACTTATAGG + Intronic
1118043891 14:61945987-61946009 ATTGATCAACTCCCACTTATGGG - Intergenic
1118052502 14:62044514-62044536 ATTGTTCAACTCCTACTTATGGG + Intronic
1120732440 14:88018838-88018860 ATTGTTCAACTCCCACTTATGGG - Intergenic
1122358664 14:101142680-101142702 ATTGTTCAGCTCCCTCTTATGGG + Intergenic
1122391196 14:101386310-101386332 ATTGTTCAACTCCCACTTATGGG + Intergenic
1126563305 15:50068405-50068427 CTTGTTGATATCCTAGTTATTGG - Intronic
1127095458 15:55508245-55508267 CTTGTTGCTCTCCTATTTATAGG + Intergenic
1127218152 15:56847034-56847056 ATTGTTTGGCTCCCACTTATGGG + Intronic
1127530357 15:59837617-59837639 CTGGTTCTGCTCCTACCTCTTGG + Intergenic
1128035229 15:64519079-64519101 ATGGTTCAGTTCCTAATTATAGG - Intronic
1130200380 15:81820547-81820569 CTTGCTCATCTCCTATTTTTTGG - Intergenic
1130400768 15:83551209-83551231 CTTGTTCACCATCTACTTCTTGG - Intronic
1132253939 15:100357700-100357722 ATTGTTCAGCTCCCACTTATGGG - Intergenic
1132472078 16:110484-110506 CTTATTAACCTCCTTCTTATGGG - Intronic
1133656071 16:7865729-7865751 ATTGTTCAACTCCCACTTATGGG - Intergenic
1133974062 16:10587795-10587817 CTTACTGAGCACCTACTTATTGG + Intergenic
1137374007 16:47936124-47936146 ATTGTTTAGCTCCTATTTATAGG + Intergenic
1137828620 16:51522695-51522717 ATTGTTCAACTCCCACTTATGGG - Intergenic
1137874749 16:51985376-51985398 CTTTTTTAGCTCCCACATATGGG - Intergenic
1138622656 16:58224240-58224262 TTTATTCAGCACCTGCTTATTGG + Intergenic
1138891141 16:61145537-61145559 CTCTTTCAGCTCAAACTTATGGG - Intergenic
1139156642 16:64451121-64451143 ATTGTTCACCTCCTGCTTAGAGG - Intergenic
1140626931 16:76805085-76805107 ATTGTTTAGCTCTTACTTAATGG + Intergenic
1141031173 16:80590289-80590311 ATTGTTCAACTCCCACTTATGGG - Intergenic
1141407047 16:83803986-83804008 CTTGTTGAGCTACTGCTCATAGG - Intergenic
1143170059 17:4923799-4923821 ATTGTTTAGTTCCCACTTATAGG + Intergenic
1143922935 17:10345161-10345183 CTGGGACAGCTCCTCCTTATTGG - Intronic
1144013225 17:11170129-11170151 CTTATTCAGCACCTACATCTGGG + Intergenic
1144400653 17:14895955-14895977 ATTGTTTAGCTCCAACTTGTAGG + Intergenic
1146133694 17:30299630-30299652 CTTGTTGAACACCTACTGATTGG + Intergenic
1150982863 17:70163341-70163363 ATTGTTCAGTTCCCACCTATGGG + Intergenic
1151831251 17:76553108-76553130 GTCCTTCAGCTCCTACTTAATGG + Intronic
1152883592 17:82834645-82834667 ACTGTTCAGCTCCCACTTATGGG - Intronic
1154088613 18:11334346-11334368 ATTGTTCAAATCCCACTTATGGG + Intergenic
1155664116 18:28286519-28286541 ATTGTTCAACTCCCACTTATGGG - Intergenic
1156529357 18:37799777-37799799 ACTGTTCAGCTCCCACTTATGGG + Intergenic
1157983595 18:52411311-52411333 CTTCTTCAGCTCTTAGTTACTGG + Intronic
1158750798 18:60257902-60257924 TATGTTTAGCTCCTACTTATTGG - Intergenic
1159112159 18:64072061-64072083 CTTGTTCAGCTTCCAGTTTTTGG + Intergenic
1160355667 18:78226471-78226493 CTTGTGCATCTCCTACTCTTTGG - Intergenic
1160359674 18:78262943-78262965 CTTGTTCTGTTTCTTCTTATAGG - Intergenic
1161617085 19:5277295-5277317 CTTGATCAGTTCCTTTTTATTGG - Intronic
1162900152 19:13790299-13790321 CTAGTCCAGCTCCTACTGCTGGG + Intergenic
1164432853 19:28203227-28203249 ATAGTTTAGCTCCCACTTATAGG - Intergenic
1164922501 19:32099578-32099600 ATTGTTCAACTCCCTCTTATAGG + Intergenic
925566703 2:5262547-5262569 ATTGTTCAGCTCCCACTTATGGG - Intergenic
927227150 2:20779278-20779300 AATGTTCACCTCCCACTTATGGG - Intronic
928133728 2:28672422-28672444 ATTGTTCAGCTCCCACTTACGGG - Intergenic
928265221 2:29805556-29805578 ATTATTCAGCTTCCACTTATAGG + Intronic
929911610 2:46094555-46094577 ATCGTTCAGCTCCCACTTGTAGG - Intronic
933137254 2:78753339-78753361 CTTATTCAGCTCCCACTTATAGG - Intergenic
934058887 2:88275675-88275697 ATTGTTCAGCTCCCACTAATGGG + Intergenic
934721885 2:96584594-96584616 CTTTTTTAGCTCCTACCTGTGGG + Intergenic
935551629 2:104464013-104464035 ATTGTTTAGCTCCTACGTATAGG + Intergenic
935591836 2:104852264-104852286 CTTGTCCAGCTCCTGCTTGCCGG - Intergenic
935929581 2:108109333-108109355 ATCATTCAGCTCCTACTTAAAGG + Intergenic
936695555 2:114943112-114943134 ATTGTTCAGCTCTCACTTACAGG + Intronic
936766387 2:115854033-115854055 CTTGTTTAGCCCCCACATATGGG + Intergenic
937356595 2:121201718-121201740 CTTTTTCAGCTCCTGCTGAATGG - Intergenic
939495754 2:142926058-142926080 ATTGTTCAACTCCCACTTATGGG - Intronic
939505687 2:143044048-143044070 ATTGTTCAACTCTCACTTATGGG + Exonic
939912907 2:148005330-148005352 ATTGTTCAGCTCCCACTTATGGG - Intronic
941607947 2:167623530-167623552 ATTGTTCAACTCCCACTTATGGG - Intergenic
942317412 2:174708540-174708562 GTTGTACAACTCCTACATATTGG + Intergenic
942616959 2:177801399-177801421 TTTGTTGAGCTTCTACTTTTTGG - Intronic
942727743 2:179027943-179027965 AATGTTTAGCTCCCACTTATAGG + Intronic
943278011 2:185893015-185893037 CTTTTTCAGCACCTGTTTATTGG - Intergenic
943443717 2:187955872-187955894 ATTGTTTAACTCCCACTTATGGG - Intergenic
943492122 2:188567566-188567588 ATTGTTCAACTCCCACTTCTGGG - Intronic
945110869 2:206358048-206358070 CTTTTTAAGGTCCTACATATGGG + Intergenic
945198728 2:207261111-207261133 TTTGTTTATCTACTACTTATGGG + Intergenic
947064388 2:226205395-226205417 TTTGTTCAGATCATATTTATTGG + Intergenic
948044833 2:234935676-234935698 CTTTATCAGAGCCTACTTATGGG + Intergenic
948260383 2:236600059-236600081 ATTGTTCAGCTCCCACTTATAGG + Intergenic
948722869 2:239912399-239912421 CTGGGTCAGCTCCTACTTGGTGG + Intronic
1168987031 20:2058244-2058266 ATTGATCAGCTCCCACTTATAGG - Intergenic
1170270290 20:14519991-14520013 ATTGTTTAGCTCCCACTTATAGG - Intronic
1170369663 20:15635515-15635537 AATGTTTAGCTCCCACTTATAGG - Intronic
1171397302 20:24844352-24844374 ACTGTTCAACTCCCACTTATGGG + Intergenic
1171778044 20:29389138-29389160 CATGTTTAGATTCTACTTATAGG + Intergenic
1171819817 20:29824530-29824552 CATGTTTAGATCCTACTTATAGG + Intergenic
1171898010 20:30828693-30828715 CATGTTTAGATCCTTCTTATAGG - Intergenic
1174692312 20:52518495-52518517 CTAGTTTAGCTCCCACTTATAGG + Intergenic
1176685231 21:9842009-9842031 TTTGTTTAGCTCCTGCATATGGG - Intergenic
1177507379 21:22036267-22036289 ATCATTTAGCTCCTACTTATAGG + Intergenic
1178225535 21:30713312-30713334 TTATTTTAGCTCCTACTTATGGG - Intergenic
1178628406 21:34238224-34238246 ATTGTTTACCTCCCACTTATAGG - Intergenic
1180323817 22:11349221-11349243 CATGTTTAGATCCTACTTATAGG + Intergenic
1181444718 22:22960164-22960186 TTTGCTCAGCCCCTACTTGTGGG + Intergenic
1182767784 22:32771121-32771143 ATTGTTCAACTCCCACTTGTGGG + Intronic
1183409830 22:37648348-37648370 CTTGTTCACCTCCTGCTCCTCGG - Exonic
1184506101 22:44903996-44904018 CTTTTTCATTTCCTACTTCTTGG + Intronic
949140463 3:627183-627205 AATGTTTAGCTCCCACTTATAGG + Intergenic
949422979 3:3885817-3885839 ATTGTTCAACTCCCATTTATGGG + Intronic
950199634 3:11034095-11034117 CTGCTTCAGCTCCTGCTTGTGGG - Intronic
951720151 3:25689442-25689464 TTTCTTCAGCTCCTACTCACAGG - Intergenic
951742667 3:25941604-25941626 CTTATTCAACTGCTACATATTGG + Intergenic
951785356 3:26412721-26412743 CATGTTTAGCTTCCACTTATAGG + Intergenic
952658410 3:35815874-35815896 ATTGTTCAACTCTCACTTATGGG + Intergenic
953087050 3:39679542-39679564 ATAATTCAGCTCCCACTTATAGG + Intergenic
953358980 3:42278505-42278527 TTTGCTCAGCATCTACTTATGGG + Intergenic
953626748 3:44578434-44578456 GTTGTTCAGCTCCTGGTTGTGGG + Intronic
954830350 3:53416130-53416152 CTTGTCAAGTTCCTATTTATTGG + Intergenic
954949252 3:54454809-54454831 CTTTTTTAGCTTCTACATATGGG + Intronic
955918156 3:63926878-63926900 ATTGTTCAACTCCTACTTATGGG + Intronic
956244302 3:67164395-67164417 ATTGTTCAGCTCCCACTTATGGG - Intergenic
956330316 3:68099925-68099947 AATGTTTAGCTCCCACTTATAGG - Intronic
957087115 3:75691415-75691437 CATGTTTAGATTCTACTTATAGG - Intergenic
957405556 3:79772523-79772545 GTTGTTCAGCTCTTAATTAGTGG - Intergenic
957603053 3:82363341-82363363 TTTATTGAGCACCTACTTATAGG - Intergenic
957623240 3:82623057-82623079 GTTGTTCAACTCCCCCTTATGGG + Intergenic
958620852 3:96557579-96557601 ATCATTCAGCTCCCACTTATAGG - Intergenic
958854419 3:99367367-99367389 TTTGTTCAGCAACTACTCATTGG - Intergenic
958910771 3:99991667-99991689 ATTGTGTAGCTCCCACTTATAGG + Intronic
958924112 3:100139119-100139141 ATTGTTCAACTCCCACTTATGGG - Intronic
958952664 3:100433281-100433303 ATTGTTCAACTCCCACTTGTGGG + Intronic
959458979 3:106600957-106600979 AGTGGTTAGCTCCTACTTATAGG - Intergenic
959497283 3:107066200-107066222 TTTGTTCAGCTTCTGCTTAGTGG - Intergenic
960437364 3:117644087-117644109 ATCATTCAGCTCCCACTTATAGG + Intergenic
963373560 3:144434395-144434417 ATTGTTCAGCTCCTACTTATAGG - Intergenic
963487028 3:145947711-145947733 ATCGTTCAGTTCCCACTTATAGG + Intergenic
964805380 3:160603980-160604002 ATTGTTCAGTTCCCACTTATGGG + Intergenic
966572873 3:181466529-181466551 AATGTTTAGCTCCCACTTATAGG + Intergenic
967182523 3:186918800-186918822 ATTGTTCACCTCCTTCTGATTGG + Intergenic
967434441 3:189428397-189428419 AATGTTTAGCTCCCACTTATAGG - Intergenic
967635665 3:191799876-191799898 ACTGTTTAGCTCCCACTTATAGG - Intergenic
969124759 4:4938661-4938683 TTAGCTTAGCTCCTACTTATTGG - Intergenic
970288727 4:14548875-14548897 ATTGTTCAACTCCCACTTCTGGG - Intergenic
971834960 4:31750673-31750695 ATTGTTCAACTCCCACTTATGGG + Intergenic
972058634 4:34837762-34837784 ACTGTTCAACTCCTACTTATGGG + Intergenic
972219900 4:36942357-36942379 ATTGTTTAGCTCCCACTTATAGG - Intergenic
973180858 4:47265165-47265187 ATTATTTAGCTCCCACTTATAGG + Intronic
973269476 4:48247220-48247242 CTTGTTCAGTTTCTATTTTTTGG - Intronic
973830174 4:54751282-54751304 ATTATTTAGCTCCCACTTATAGG - Intergenic
974039793 4:56847575-56847597 CTTGTTCAGCTGACACTTAAAGG + Intergenic
974180720 4:58381025-58381047 ATTGTTCAGCTCCCACTTATGGG + Intergenic
975133538 4:70851622-70851644 GTTGTCCAGCTTCTGCTTATAGG - Intergenic
975155672 4:71069528-71069550 CTTGTTAAGCTGCTGTTTATAGG + Intergenic
975479835 4:74865725-74865747 ATTGTTCAACTCCCACTTATGGG - Intergenic
977985615 4:103379662-103379684 ATTATTTAGCTCCCACTTATAGG - Intergenic
978266450 4:106832004-106832026 AATGTTTAGCTCCTGCTTATAGG - Intergenic
978383282 4:108153166-108153188 CTTGCTCAGTTCCTGCTTCTAGG - Intronic
978554650 4:109966265-109966287 ATTGTTCAGCTCTCACATATAGG + Intronic
978592374 4:110339185-110339207 CTTGTTTTGCTCCTAATTTTAGG + Intergenic
979754723 4:124326491-124326513 ATTGTTCAACTCCCACTTATGGG - Intergenic
979758126 4:124367160-124367182 ATTGTTCAGTTCCCACCTATGGG - Intergenic
980348688 4:131660477-131660499 TTTGTTTAGCTCCTGCATATGGG - Intergenic
981154936 4:141423760-141423782 ATTGTTCAACTCCCACTTATGGG + Intergenic
982421236 4:155200781-155200803 ATTGTTCAACTCCCACTTATGGG - Intergenic
983785544 4:171725646-171725668 CATGTTTAGCTCCCAATTATAGG - Intergenic
983807500 4:172013373-172013395 CTTTTTTAGCTCCCACATATGGG + Intronic
984178993 4:176457381-176457403 ATTGTTTAGCTCCCACTTATAGG - Intergenic
985030291 4:185782065-185782087 CTTATTCAGCAACTACGTATTGG - Intronic
1202768342 4_GL000008v2_random:171949-171971 ATCGTTCAGCTCCCACTTATAGG - Intergenic
985751210 5:1677208-1677230 CTGTTTCAGCTCCCACATATGGG + Intergenic
986803388 5:11284476-11284498 ATTGTTCAGTTCCCACTTAGAGG + Intronic
987471245 5:18331193-18331215 ATTGTTCAGCTCCCACTTATAGG + Intergenic
988195459 5:27999570-27999592 ATTGTTTAGATCCCACTTATAGG + Intergenic
988423906 5:31040272-31040294 ATTGTTCAACTCCTACTTACGGG - Intergenic
988443460 5:31258415-31258437 ATTGTTCAACTCCCACTTATGGG - Intronic
988797436 5:34664836-34664858 ATAGCTTAGCTCCTACTTATGGG + Intronic
989075419 5:37560371-37560393 CTAGTTCAGCTCCTTCTGTTAGG + Intronic
989324991 5:40181946-40181968 ATTGTTAAACTCCCACTTATGGG - Intergenic
990092447 5:52070064-52070086 CTTTTTCAGATGCTACATATGGG - Intronic
990128185 5:52545059-52545081 TTTTATAAGCTCCTACTTATTGG + Intergenic
990233175 5:53737382-53737404 ATTGTTCAACTCTCACTTATGGG - Intergenic
990951708 5:61304929-61304951 CTTGTTCTCCTCCTATTTATTGG + Intergenic
991014747 5:61918783-61918805 CAGGTTCAGCTCCTACTTCAAGG + Intergenic
992222516 5:74586807-74586829 ATTGTTCTGCCCCTACTTATTGG - Intergenic
992237293 5:74724043-74724065 CTTGTTAAGCTTCTTCTAATGGG - Intronic
992342061 5:75834487-75834509 ATTGCTCAGCTCCCACTTATAGG - Intergenic
993230336 5:85227090-85227112 ATCATTCAGCTCCCACTTATAGG + Intergenic
993429904 5:87819355-87819377 TCAGTTTAGCTCCTACTTATAGG - Intergenic
993478677 5:88396460-88396482 CATGTTCACATCCTTCTTATGGG + Intergenic
993826379 5:92692258-92692280 ATTGTTCAACTCCCACTTATGGG - Intergenic
993923530 5:93837176-93837198 ATTGTTTAGCTCTCACTTATAGG + Intronic
994028895 5:95117941-95117963 ATTGTTCAGCTCCCATTTATAGG - Intronic
995252027 5:110004730-110004752 ATTGTTCAACTCCCACTTATGGG + Intergenic
995263018 5:110127524-110127546 ATTATTTAGCTCCTACTTATGGG + Intergenic
995263346 5:110131145-110131167 ATTGTTCAACTCCTACTTATGGG + Intergenic
995603809 5:113828730-113828752 AATGTTTAGCTCCCACTTATAGG + Intergenic
995798316 5:115963636-115963658 ATTGTTCAATTCCTACCTATGGG - Intronic
996109794 5:119551903-119551925 ATTGTTCAGCTCCCACTTACAGG + Intronic
996476165 5:123924053-123924075 ATTGTTTAGCTCCCACTTAAAGG + Intergenic
998542486 5:142995970-142995992 ATTGTTCAGCTCCCACTTATGGG - Intronic
998611789 5:143696891-143696913 CTTGCTCAGTTTCTACTTCTCGG - Intergenic
998649094 5:144097866-144097888 ATTATTTAGCTCCCACTTATAGG - Intergenic
998934547 5:147220261-147220283 AATGTTCAACTCCCACTTATCGG - Intergenic
999677819 5:154023064-154023086 ATTGTTCAGTTCCCACCTATGGG - Intronic
1000522016 5:162307106-162307128 ATTGTTCAACTCCCACTTATGGG - Intergenic
1000618291 5:163454792-163454814 TTTGTTGAGCTCCTACTGTTTGG + Intronic
1001146284 5:169187494-169187516 CTTGGTCTGCTCATCCTTATAGG + Intronic
1002821195 6:726601-726623 TTTATTCAGCTCTTACTTATCGG - Intergenic
1003710527 6:8584513-8584535 ATTGTTCAACTCCCACTTACGGG + Intergenic
1003850254 6:10215268-10215290 CTGGTACATCTCCTACTTTTTGG - Intergenic
1004239785 6:13910201-13910223 ATTGTTCAGCTCCCACTTATAGG - Intergenic
1005159446 6:22842216-22842238 TTTGTTTAGCTCCCACTTATAGG - Intergenic
1005279595 6:24258838-24258860 CTTGCTTAGCTCCTATTGATTGG - Intronic
1008431158 6:51418913-51418935 ATTGTTTAGCTCCCACTTATGGG + Intergenic
1009961466 6:70527769-70527791 TTCGTTCTGCTCCTTCTTATTGG + Intronic
1010616705 6:78021708-78021730 ATTGTTCAACTCCCACTTATGGG - Intergenic
1010913499 6:81587463-81587485 ATTGTTCAACTCCCACTTATGGG + Intronic
1011396261 6:86912071-86912093 TATGTTTAGCTCCCACTTATAGG - Intergenic
1011504908 6:88030831-88030853 AATGTTTAGCTCCCACTTATAGG - Intergenic
1011609291 6:89134614-89134636 CTATTTCTGGTCCTACTTATTGG - Intergenic
1012559877 6:100567620-100567642 ACTGTTTAGCTCCCACTTATAGG + Intronic
1012979213 6:105812242-105812264 GTTGTTCAGCTACTACTGCTTGG + Intergenic
1013052621 6:106551197-106551219 AATGTTTAGCTCCCACTTATGGG + Intronic
1013181959 6:107724968-107724990 CTTTTTTAGCTCCCACATATGGG - Intronic
1013681809 6:112532507-112532529 ATTGTTCAGTTCCCACCTATGGG + Intergenic
1014023045 6:116613208-116613230 ATTGTTCAGTTCCCACTTATAGG - Intergenic
1014328072 6:120024761-120024783 CTTATTCAGCTCCCACCTATTGG - Intergenic
1014841087 6:126220975-126220997 AATGTTTAGCTCCCACTTATTGG + Intergenic
1016076218 6:139799158-139799180 ATTGTTCAGCTCTTTCTTCTTGG + Intergenic
1016703243 6:147077508-147077530 CTTGTTCAGTTCCCGTTTATGGG - Intergenic
1017293553 6:152768751-152768773 CTTGTTGAGCAGCTGCTTATAGG + Intergenic
1019897230 7:3991901-3991923 CATGTTCAGCTGCTTCTTAAGGG - Intronic
1020491367 7:8788346-8788368 AGTGTTTAGCTCCCACTTATAGG + Intergenic
1021200828 7:17727079-17727101 ACTGTTCAACTCCCACTTATGGG - Intergenic
1021243611 7:18235037-18235059 CTTGTTCAGATTCTTCTTAGGGG + Intronic
1021355021 7:19643665-19643687 TTTTTTTAGCTCGTACTTATAGG - Intergenic
1021416536 7:20392732-20392754 ATTATTTAGCTCCCACTTATGGG + Intronic
1021532438 7:21663042-21663064 ATTGTTTAGCTCCCACTTATAGG + Intronic
1021618469 7:22527031-22527053 AGTGTTTAGCTCCTACTTATAGG - Intronic
1022928062 7:35076484-35076506 AGTGTTTAGCTCCTACTTATAGG - Intergenic
1023280795 7:38567317-38567339 ATTGTTCAGCTCCCACCTATGGG - Intronic
1023835029 7:44062860-44062882 CTTGTTCAGCTCATACACAATGG + Exonic
1024250178 7:47500457-47500479 CTTGTTCTGCTCCCTCTTACAGG - Intronic
1024405480 7:48974694-48974716 ATTGTTTAGCTCCCACTTATAGG - Intergenic
1024927284 7:54630532-54630554 AATGTTTAGCTCCCACTTATAGG + Intergenic
1026422148 7:70250791-70250813 GTTGTTTAGCTCCCACTCATAGG - Intronic
1027444729 7:78260199-78260221 CTTGTTCAGATAGAACTTATTGG + Intronic
1027558864 7:79701839-79701861 AATGTTTAGCTCCCACTTATAGG + Intergenic
1027997245 7:85439911-85439933 ATTGTTCAACTTCCACTTATGGG - Intergenic
1028080821 7:86573100-86573122 ATTGTTCAACTCCCACTTATGGG - Intergenic
1028374213 7:90129104-90129126 AGTGTTTAGCTCCTACTTATAGG + Intergenic
1029594448 7:101529639-101529661 CTTGTTCAGCTCCTACTTATAGG + Intronic
1030237302 7:107278483-107278505 ATTGGTCAACTCCCACTTATGGG + Intronic
1030702471 7:112656431-112656453 ATTGTTCAACTCCTACTTATGGG + Intergenic
1030735441 7:113042618-113042640 CTTATTCAGCTCCTAGTTTAAGG - Intergenic
1031033099 7:116756144-116756166 CTTGTTCAGCTCTTACTCTCTGG - Intronic
1031699571 7:124906417-124906439 ATTGTTCAGTTCCCACCTATGGG - Intronic
1031785720 7:126028810-126028832 ATTGTTCAGCTCCCACTTATAGG + Intergenic
1032542184 7:132712322-132712344 CTTGTTCTCCTCCTACTTCAAGG + Intronic
1033951592 7:146791153-146791175 ATTGTTCAACTCCCACTTATGGG + Intronic
1034683499 7:152949172-152949194 TTTGTTGAGCTCCCACTTAGAGG + Intergenic
1035779718 8:2217811-2217833 ATTGTTCAATTCCTACCTATGGG + Intergenic
1036985075 8:13520401-13520423 ACTGTTCAACTCCCACTTATGGG - Intergenic
1037232481 8:16675056-16675078 ATTGTTCAACTCCCACCTATGGG - Intergenic
1037380426 8:18279330-18279352 CTTATTCAGCTACTATTCATAGG - Intergenic
1037601674 8:20401418-20401440 ATTATTCACCTCCCACTTATTGG + Intergenic
1038100818 8:24372598-24372620 ATTGTTCAACTCCCACTTTTGGG - Intergenic
1038307029 8:26414159-26414181 CTTGGTCACCTCCTACTTTTGGG - Intronic
1038395407 8:27242433-27242455 CTTGTTCTGCTCCTGCTTCCTGG - Exonic
1038414184 8:27381398-27381420 CTTTTTTAGCTCCCACCTATGGG + Intronic
1038998973 8:32958426-32958448 AATGTTTAGCTCCCACTTATAGG + Intergenic
1039309384 8:36299088-36299110 AATGTTTGGCTCCTACTTATAGG + Intergenic
1040383873 8:46899884-46899906 ATTGTTCATTTCCCACTTATGGG - Intergenic
1040719178 8:50296541-50296563 CATTTTCAACTCCCACTTATGGG - Intronic
1040734804 8:50491948-50491970 ACTGTTCAACTCCCACTTATGGG + Intronic
1040860432 8:51993498-51993520 ATCGTTCAGCTCCCACTTATAGG - Intergenic
1041612649 8:59870011-59870033 ATTGTTCAGTTCCCACCTATGGG + Intergenic
1042675004 8:71310476-71310498 ATTATTTAGCTCCCACTTATAGG + Intronic
1043982578 8:86658541-86658563 CTTGTGGAGCTCCTTCTCATAGG + Intronic
1044200094 8:89424603-89424625 AATGTTTAGCTCCCACTTATAGG - Intergenic
1045968125 8:108049616-108049638 ATTATTCAACTCCCACTTATGGG + Intronic
1046664254 8:116981630-116981652 AATGTTCAGCTCCCACTTGTGGG + Intronic
1046947115 8:119984481-119984503 GTTGTTCAGCTCCCACTTATGGG + Intronic
1047201047 8:122768049-122768071 ATTGTTCAACTCCCACTTATGGG - Intergenic
1047631218 8:126710885-126710907 ATTGTTCAACTCCCACTTTTGGG - Intergenic
1047890833 8:129306842-129306864 CTTAATCAGCTCCTACTTATGGG - Intergenic
1048778179 8:137971011-137971033 ATTGTTAAACTCCCACTTATGGG - Intergenic
1050150358 9:2613810-2613832 CTTGTTGAGCACCTTCTTTTGGG - Intergenic
1050645847 9:7718826-7718848 ATTGTTCAGTTCCCACCTATGGG - Intergenic
1050918267 9:11164711-11164733 GTTGTTCAGCTTCGGCTTATAGG + Intergenic
1051567632 9:18518364-18518386 ATTGTTTAGCTCCTGCTTATAGG + Intronic
1051591780 9:18783418-18783440 CTTGTTTAACTCCAAATTATGGG - Intronic
1051734286 9:20182563-20182585 ATTGTTCAACTCCCACTTATGGG - Intergenic
1051976592 9:22957572-22957594 AATGTTTAGCTCCCACTTATAGG + Intergenic
1052040091 9:23728370-23728392 CTTTTGCAGCTCCGACTTTTTGG - Intronic
1052127306 9:24793017-24793039 ATTGTTCAGCTCCCACTTATGGG - Intergenic
1052159030 9:25232383-25232405 ATTATTTAGCTCCCACTTATAGG + Intergenic
1052746220 9:32444033-32444055 ATTGTTCAACTCCCACTTATGGG + Intronic
1053373582 9:37584602-37584624 CTTGGCCAGCTGCTACTCATTGG + Intronic
1053460758 9:38269218-38269240 CTTTTTTAGCTCCCACATATGGG - Intergenic
1053724776 9:40988340-40988362 AGTGTTTAGCTCCCACTTATAGG + Intergenic
1053750575 9:41250445-41250467 CATGTTTAGATCCTACTTATAGG - Intergenic
1053784084 9:41639600-41639622 TTTGTTTAGCTCCTGCATATGGG + Intergenic
1054172038 9:61849736-61849758 TTTGTTTAGCTCCTGCATATGGG + Intergenic
1054256082 9:62814788-62814810 CATGTTTAGATCCTACTTATAGG - Intergenic
1054335226 9:63800824-63800846 CATGTTTAGATCCTACTTATAGG + Intergenic
1054341196 9:63863659-63863681 AGTGTTTAGCTCCCACTTATAGG - Intergenic
1054446900 9:65378749-65378771 TTTGTTTAGCTCCTGCATATGGG + Intergenic
1054665499 9:67731071-67731093 TTTGTTTAGCTCCTGCATATGGG - Intergenic
1055195516 9:73588112-73588134 AATGTTCAGCTCCCATTTATGGG - Intergenic
1057151500 9:92800049-92800071 ATTGTTCAACTCCCACTTATGGG - Intergenic
1057967929 9:99522377-99522399 ATTGTCTAGTTCCTACTTATAGG + Intergenic
1058276486 9:103047981-103048003 ATAGTTTAGCTCCCACTTATTGG - Intergenic
1059086559 9:111309466-111309488 CTTTTTTAGCTCCTACATATGGG - Intergenic
1060683039 9:125582691-125582713 CTTGTTCAGCTTCTTTTCATAGG + Intronic
1203371491 Un_KI270442v1:309795-309817 CATGTTTAGATCCTACTTATAGG + Intergenic
1185489631 X:511423-511445 ATTGTTCAGCTCCCACTTATGGG - Intergenic
1185669786 X:1798630-1798652 ATTGTTCAACTCCCACTTATGGG + Intergenic
1186318970 X:8403438-8403460 TTTGTTCAGCTCAGACTTTTAGG - Intergenic
1187272195 X:17789281-17789303 CGTGTGCACCTCCTACTCATGGG + Intergenic
1187385082 X:18841146-18841168 GTTGTTCAGCTTCAGCTTATAGG - Intergenic
1187584649 X:20646795-20646817 ATTGTTCAGCTCCCAGTTATAGG - Intergenic
1187778924 X:22795327-22795349 ATTGTTCAGCTCCCGCTTATGGG - Intergenic
1188015359 X:25102374-25102396 ATTGTTCAACTCCCACCTATGGG - Intergenic
1188154999 X:26730829-26730851 ATTGTTCAACTCCCACTTATGGG + Intergenic
1188224409 X:27579335-27579357 ATTGTTCAGCTACCACTTATAGG - Intergenic
1188623748 X:32258591-32258613 ATCGTTCAACTCCCACTTATGGG - Intronic
1188727392 X:33602578-33602600 ATTATTAAGCTCCCACTTATAGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189257545 X:39652187-39652209 CTTGCTCAGCTCCTTCCTTTGGG - Intergenic
1190805563 X:53833033-53833055 CTTTTTTAGCTCCCACATATGGG + Intergenic
1190852481 X:54259308-54259330 GTTGTTCAGCTCCAACTGGTTGG + Exonic
1190993470 X:55578920-55578942 CATGTTTAGTTCCCACTTATAGG - Intergenic
1191086768 X:56576440-56576462 GATGTTTAGCTCCCACTTATAGG + Intergenic
1191227837 X:58064239-58064261 ATTGTTCAACTCCCTCTTATTGG - Intergenic
1191768365 X:64727494-64727516 ATTGTTCAGCTCACATTTATAGG + Intergenic
1192662640 X:73058269-73058291 ATTTTTCAACTCCCACTTATGGG - Intergenic
1192720869 X:73696556-73696578 ATTGTTCAACTCCCACTTATGGG - Intergenic
1192797180 X:74433572-74433594 AATGTTTAGCTCCCACTTATAGG + Intronic
1192865651 X:75129374-75129396 ATTGTTCAACTCCCACTTAAGGG - Intronic
1192957034 X:76082669-76082691 ATTGTTCAGCTCCCACTTATAGG + Intergenic
1193053285 X:77124217-77124239 ATTGTTCAGTTCCCACCTATGGG - Intergenic
1193079872 X:77396097-77396119 GTTGTTCAACTCCCAGTTATGGG - Intergenic
1194052202 X:89083352-89083374 CTTGATCAGCTCTTATTTTTTGG + Intergenic
1194287319 X:92025974-92025996 CTTGTTTAGCTCTCACTTACAGG - Intronic
1195345607 X:103947967-103947989 ATTGTTCAACTCTCACTTATGGG - Intronic
1196232233 X:113237563-113237585 ATTGTTCAGCTCGCACTTATGGG + Intergenic
1196260147 X:113569449-113569471 ACTGTTCAGCTCCCACTTATGGG + Intergenic
1196304992 X:114091108-114091130 TTTGTCCATCTCCAACTTATTGG - Intergenic
1196596698 X:117554107-117554129 CTTGTCCAGTTCCTACTTTTTGG - Intergenic
1196626817 X:117886173-117886195 ATTATTTAGCTCCCACTTATAGG + Intergenic
1198585120 X:138111953-138111975 ATTGTTTAGCTCCCACTTACAGG - Intergenic
1198623201 X:138536791-138536813 ATTGTTCAGCTCCCACTTATAGG - Intergenic
1198824670 X:140686810-140686832 ATTGTTCAACTTCCACTTATGGG - Intergenic
1199095929 X:143738599-143738621 TCAGTTCAGCTCCCACTTATAGG - Intergenic
1199403179 X:147424688-147424710 CAAGTTCAACTCCTACTTATGGG - Intergenic
1199718145 X:150522054-150522076 TTTGTTCATTTCCTCCTTATTGG - Intergenic
1199811739 X:151356634-151356656 ATTGTTCAACTCCCACTTATGGG - Intergenic
1199976978 X:152899893-152899915 CTTGCTGAGCTCCTGCATATGGG + Intergenic
1200604855 Y:5250540-5250562 CTTGTTTAGCTCTCACTTACAGG - Intronic
1200946434 Y:8845042-8845064 ATTATTCAGCTCCCTCTTATAGG - Intergenic
1201066854 Y:10105332-10105354 CATGTTTAGATCCTACTTATAGG - Intergenic
1201184040 Y:11380593-11380615 AGTGTTTAGCTCCCACTTATAGG - Intergenic
1201866687 Y:18663284-18663306 ATTGTTCAACTCCCACTTACTGG + Intergenic
1201931326 Y:19352604-19352626 GTTGTTCAGCTCTTATTTATAGG + Intergenic