ID: 1029597202

View in Genome Browser
Species Human (GRCh38)
Location 7:101544148-101544170
Sequence GCTTTCTTCTCTACTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029597189_1029597202 19 Left 1029597189 7:101544106-101544128 CCCCCCACATATGTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG 0: 1
1: 0
2: 2
3: 16
4: 201
1029597190_1029597202 18 Left 1029597190 7:101544107-101544129 CCCCCACATATGTGATGTTGTCA 0: 1
1: 0
2: 0
3: 15
4: 127
Right 1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG 0: 1
1: 0
2: 2
3: 16
4: 201
1029597200_1029597202 -6 Left 1029597200 7:101544131-101544153 CCTGCGGAAGGGGCTGGGCTTTC 0: 1
1: 0
2: 1
3: 12
4: 203
Right 1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG 0: 1
1: 0
2: 2
3: 16
4: 201
1029597193_1029597202 15 Left 1029597193 7:101544110-101544132 CCACATATGTGATGTTGTCAACC 0: 1
1: 0
2: 0
3: 5
4: 132
Right 1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG 0: 1
1: 0
2: 2
3: 16
4: 201
1029597192_1029597202 16 Left 1029597192 7:101544109-101544131 CCCACATATGTGATGTTGTCAAC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG 0: 1
1: 0
2: 2
3: 16
4: 201
1029597191_1029597202 17 Left 1029597191 7:101544108-101544130 CCCCACATATGTGATGTTGTCAA 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG 0: 1
1: 0
2: 2
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029597202 Original CRISPR GCTTTCTTCTCTACTGGAAC AGG Intronic
903962797 1:27067390-27067412 TATTTCTTATCTTCTGGAACAGG - Intergenic
905768683 1:40623727-40623749 GCATTCTCCTCTTCTGGGACAGG + Exonic
906877110 1:49551680-49551702 GCTATCACCTCCACTGGAACAGG - Intronic
910058065 1:83055547-83055569 GCTTTCTTGACAATTGGAACAGG - Intergenic
910490635 1:87765589-87765611 CCTTTCTTCTCTACAAGGACTGG - Intergenic
910716507 1:90236708-90236730 GCTTTATTCTCTGCTGTGACAGG + Intergenic
912913770 1:113790462-113790484 AATATCTTCTCTACTGTAACAGG + Intronic
913370318 1:118091962-118091984 GCTTTCTTCTTTCCAGGAGCTGG + Exonic
913531283 1:119735977-119735999 GCACTCTTCCCTACTGGATCTGG - Intronic
913561393 1:120024186-120024208 TCTTTCTTCTCAGCTGAAACTGG - Intronic
913636734 1:120769416-120769438 TCTTTCTTCTCAGCTGAAACTGG + Intergenic
914281978 1:146183595-146183617 TCTTTCTTCTCAGCTGAAACTGG - Intronic
914623615 1:149436710-149436732 TCTTTCTTCTCAGCTGAAACTGG + Intergenic
915149568 1:153819636-153819658 TCTTTCTTCCATTCTGGAACTGG + Exonic
917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG + Intronic
919108132 1:193180616-193180638 CCTGTCTTCTGTTCTGGAACTGG - Exonic
921551299 1:216538464-216538486 TCTTTCTGCTCTAATGGAAAGGG + Intronic
922316507 1:224447366-224447388 GATTTCCTCTCTCCTGGAGCTGG - Intronic
923024104 1:230190643-230190665 TCTCTCTTCTCTCCTGAAACGGG + Intronic
1062838164 10:650069-650091 GCTATTTTCTCTCCTGGAACTGG - Exonic
1062986521 10:1774042-1774064 GCTTTATTCTATGCTGTAACTGG + Intergenic
1063028233 10:2204448-2204470 GCTGGCTTCTTTACTGCAACCGG - Intergenic
1066143100 10:32527167-32527189 GCTTTATTCTCTGCTGTGACAGG + Intronic
1066448196 10:35503325-35503347 GATTTCTTTTCTATAGGAACAGG - Intronic
1072399990 10:95087742-95087764 GCTTTCCTTTCTGCTGTAACAGG + Intergenic
1072853755 10:98924975-98924997 GCTTTATTCTCCACTGTAACAGG + Intronic
1075882453 10:125865533-125865555 GCTTTCTTTTTTTCTGGGACAGG + Intronic
1078689595 11:13565739-13565761 GCTTCCTACTCTTCTGGAACTGG - Intergenic
1079069371 11:17329543-17329565 GCTTTATTCTCTGCTGTGACAGG + Intronic
1079287823 11:19155250-19155272 GTTTTCTTCTCTACAAGAAATGG - Intronic
1079426792 11:20351206-20351228 ACTGTCTTCCCTACTGGACCTGG - Intergenic
1080195828 11:29607601-29607623 ACTTTCTTCACTAATGAAACAGG - Intergenic
1081677150 11:44976894-44976916 GCTTCCTTCTCAGCTGGAGCAGG - Intergenic
1081960057 11:47129433-47129455 GCTTTCTTTTCTCCTAGCACTGG + Intronic
1082089245 11:48075896-48075918 GTTGTTTTCTCTCCTGGAACTGG + Intronic
1082853596 11:57786861-57786883 GCTTTCTTCTCAACTATCACAGG - Intronic
1085223337 11:74895306-74895328 GCTTTATTCTCTGCTGTGACAGG - Intronic
1086237520 11:84649668-84649690 GGTTTGCTGTCTACTGGAACTGG + Intronic
1087887468 11:103497194-103497216 GCTTTATTCTCCACTGTGACGGG - Intergenic
1088206001 11:107393470-107393492 ACTTTATTCTCTAATGGAAATGG + Intronic
1088721143 11:112592937-112592959 GCTGTCATCTTAACTGGAACTGG + Intergenic
1090184851 11:124730893-124730915 ACTTTCTGTTCCACTGGAACAGG - Intergenic
1093392412 12:18638359-18638381 GCCTTCTTTTCTAGTGGAAGTGG - Intronic
1093907215 12:24707214-24707236 GTTTTTTTCTCTACAGGAAATGG - Intergenic
1094009863 12:25796349-25796371 TCTGCCTTTTCTACTGGAACAGG - Intergenic
1098108737 12:67099020-67099042 GTTTTCTTCTTTAGTGGATCTGG - Intergenic
1101403951 12:104412064-104412086 GCTTTATTCTTTACTGGAAAAGG - Intergenic
1102493501 12:113303673-113303695 GATTTCTTCTCTAGAGGACCTGG + Intronic
1102597067 12:114001013-114001035 GCTTTCTTCTCTACAAGGATGGG + Intergenic
1102639031 12:114349979-114350001 CCTTTGTTCTCTAATTGAACTGG - Intergenic
1103189455 12:118988734-118988756 TCTTTCTCCTCCACGGGAACAGG - Intronic
1103876143 12:124128830-124128852 CCTTTCTTTTCTACTGGTATTGG + Intronic
1105801757 13:23910660-23910682 GCACTGTTGTCTACTGGAACTGG + Intergenic
1109535394 13:63711088-63711110 TCTTTGTTCTCTAATGGAAATGG - Intergenic
1109566961 13:64130878-64130900 GCTTTGCTCTCTGCTGTAACAGG - Intergenic
1111372839 13:87338984-87339006 GCTATTTTCTGTACTGGTACAGG + Intergenic
1113813020 13:113153684-113153706 GCTTGTTTTTCTCCTGGAACTGG - Intergenic
1114345803 14:21793573-21793595 GCTTTCCCCTCTACAGGCACAGG - Intergenic
1115549130 14:34489294-34489316 GTTTTCTTCTCTCGTGGAAATGG - Intergenic
1116888955 14:50249048-50249070 GCTTTATTCTCCACTGTGACAGG - Intronic
1117339189 14:54779269-54779291 GCTTTCATCTGTACATGAACAGG + Intronic
1117568595 14:57022565-57022587 GCCTTCTTCTCTCCTGCCACAGG + Intergenic
1117713238 14:58554350-58554372 GATTTCTCTTCTAGTGGAACTGG + Intergenic
1117771331 14:59137072-59137094 GATTCCTCCTCCACTGGAACAGG + Intergenic
1120120800 14:80678566-80678588 GCATTCTTCTCCCCTGGATCTGG - Intronic
1121630973 14:95421745-95421767 GCTTTCTTCCCTGATGGGACTGG - Intronic
1124846837 15:33299783-33299805 TTTTTCTTCTCTGCTTGAACTGG + Intergenic
1129070132 15:72944048-72944070 TCTTTCTTCTGAATTGGAACTGG - Intergenic
1129323250 15:74786484-74786506 CCTTCCTTGGCTACTGGAACAGG - Intronic
1129444647 15:75608441-75608463 GCTTTCTTCTCTACCTGCTCAGG - Intronic
1131016136 15:89059166-89059188 GCTCTCTTCTCTGCTGTACCTGG + Intergenic
1134147094 16:11774079-11774101 TTTTTCTTCTCTACTGAAACTGG - Intronic
1134175263 16:12000867-12000889 GCTCTCTGCTCTTCTGTAACTGG + Intronic
1134791040 16:16989518-16989540 ATTTCCTTCTCTCCTGGAACAGG - Intergenic
1135881236 16:26259677-26259699 ATTTTCTTCTCAACTGGAAATGG - Intergenic
1138132864 16:54496715-54496737 GCCTTCATCACTGCTGGAACTGG + Intergenic
1138401806 16:56751759-56751781 TCCTTCTACTCTCCTGGAACTGG + Intronic
1144086118 17:11810139-11810161 GTTTTCTTCTCTGCTTGAATGGG - Intronic
1147926654 17:43950793-43950815 CCTGTCTTCTCTCCTGCAACAGG - Intergenic
1152116738 17:78392566-78392588 GGTTTCTGATCCACTGGAACCGG - Exonic
1152982130 18:288715-288737 TCTTTCTCCTCTCCTGTAACTGG + Intergenic
1153429356 18:4999187-4999209 GCTTTATTCTCTACTGTGACAGG - Intergenic
1154451793 18:14483862-14483884 GTTTTCATCTCTACCGGAAGTGG - Intergenic
1157118594 18:44886286-44886308 GGTCTCATCTCTACTGGAATGGG - Intronic
1157189121 18:45565869-45565891 ACTTTCTTCTCTCCTGGGTCAGG - Intronic
1157654105 18:49368640-49368662 TCTCTTTTCTCTGCTGGAACTGG - Intronic
1157991994 18:52508163-52508185 TCTTTCTTCTCTAATTGAAGAGG - Intronic
1159223444 18:65497895-65497917 GATTACTTCTCTACAGGTACAGG - Intergenic
1162972280 19:14187884-14187906 GCTTTCTTTCCCACTGCAACAGG + Intronic
926600468 2:14838930-14838952 TCTTTCTTCTCTGCTGAAACTGG - Intergenic
928495739 2:31829677-31829699 GCTTTATTCTCCACTGTGACAGG + Intergenic
928802793 2:35115054-35115076 GTTTTCTTTTCTTCTGTAACAGG - Intergenic
933454833 2:82507827-82507849 GCTTTGCTCTGTACTGGAGCGGG - Intergenic
934921646 2:98348655-98348677 GCTTTTTTCTCTACTGAGGCTGG + Intronic
935192395 2:100789327-100789349 GCTTACTTTTCTCCTGGACCTGG - Intergenic
936042903 2:109163269-109163291 TGTTTCTTCTCTAATGAAACAGG + Intronic
936641538 2:114317308-114317330 GCTTTATTCTCTACTGTGACAGG + Intergenic
936750531 2:115635635-115635657 CCTTTCTTATCAAATGGAACAGG - Intronic
938479899 2:131652266-131652288 GTTTTCATCTCTACTGGAAGTGG + Intergenic
938656924 2:133443746-133443768 GCTGTTTTCTCTACTGGAAGAGG + Intronic
939880173 2:147622426-147622448 ACTTTATTTTCTACTTGAACTGG + Intergenic
940425241 2:153524630-153524652 GCTTTCGTTTCCACTGTAACAGG - Intergenic
942698818 2:178679640-178679662 GGTTTCTTCTCTTCTGGAACAGG + Exonic
942699538 2:178689067-178689089 GCTTTCTTAGCGACAGGAACTGG + Exonic
942814411 2:180034628-180034650 GCTTTATTCTCTGCTGTGACAGG + Intergenic
945262536 2:207857934-207857956 GCTTTCTTCTTTTCTGATACAGG + Intronic
947439852 2:230109720-230109742 GCTTTGTTCTCTGCTGTGACAGG + Intergenic
948973678 2:241449062-241449084 TCTGGCTTCTCTACTGGAAGAGG - Intronic
1170439237 20:16361419-16361441 GCAGGCTTCTCTACTGGAAATGG - Intronic
1172810645 20:37645505-37645527 GGTTTCTTCTCTACTTGTGCTGG + Intergenic
1174307539 20:49624836-49624858 TCTTTCTTCCCAACTGGGACAGG - Intergenic
1175199826 20:57269115-57269137 TCCTTTTTCTCTACTGGCACTGG - Intergenic
1176444350 21:6806358-6806380 GTTTTCATCTCTACCGGAAGTGG + Intergenic
1176822515 21:13671396-13671418 GTTTTCATCTCTACCGGAAGTGG + Intergenic
1177212771 21:18091089-18091111 GCTTTATTCTCTGCTGTGACAGG - Intronic
1178711619 21:34922216-34922238 GCTGTCTTCTCCTCTAGAACCGG - Intronic
1179001003 21:37458062-37458084 GCTTTCCTCTCTAGAGGAGCAGG - Intronic
1179462176 21:41543858-41543880 CCTTCCTTCTCTCCTGGAATAGG + Intergenic
1182176161 22:28291361-28291383 GTTTTCTTCTATAGTGGTACTGG - Intronic
1182191421 22:28464858-28464880 GCTTCCTTCTGTTCTGGAAGAGG - Intronic
950372454 3:12542612-12542634 GCTTTCTTGTCTGCAGGAAAAGG - Intronic
952672929 3:35993205-35993227 GCTTTATTCTCTGCTGTGACAGG - Intergenic
956149162 3:66223082-66223104 CCTTTCTTCCCTACTTGAAATGG - Intronic
957831475 3:85526707-85526729 GCTTTATTCTCTACTAAAATGGG + Intronic
958164402 3:89861151-89861173 TGTTTCTTCTCTCCTGGTACAGG + Intergenic
958983955 3:100758892-100758914 GATTTCTTCTTTAGTGGAAGAGG + Intronic
959335981 3:105066047-105066069 GCTTTATTCTCTGCTGTGACAGG - Intergenic
959756922 3:109910571-109910593 CCTTTCACCTCCACTGGAACAGG - Intergenic
963418131 3:145025597-145025619 GATTTCCTTTCCACTGGAACCGG + Intergenic
963591587 3:147267442-147267464 GCTTTCTTCTCTAGTTGTGCTGG - Intergenic
965730113 3:171762648-171762670 CCCTTCCTCTCTCCTGGAACGGG - Intronic
969538858 4:7773429-7773451 GCTTGCATCTCTACTGGACATGG + Intronic
969909391 4:10429278-10429300 TCATTCTTCTCCACTGGAAATGG + Intergenic
970969208 4:21961892-21961914 GCTTTCTCCACTACTCGTACTGG - Intergenic
972081703 4:35159643-35159665 AATTTATTCTCTACTTGAACTGG - Intergenic
972212119 4:36851183-36851205 GCTTTCTTCTCCTCTGGTTCTGG + Intergenic
974128433 4:57723866-57723888 GCTTTCTTCAGTACAGGCACTGG + Intergenic
979740512 4:124144331-124144353 GTTTTCTTCTCTCCTGGCAATGG - Intergenic
980470851 4:133249754-133249776 GCTTTCATCTCACCTAGAACAGG + Intergenic
980588540 4:134852599-134852621 GATTTCTTCTCTACTGAGAAGGG - Intergenic
980605899 4:135088629-135088651 ACTTTTTTCTCTTCTGGAATTGG - Intergenic
980926349 4:139142033-139142055 CCTTTATTCACTACTGGACCCGG - Intronic
981194666 4:141904512-141904534 GCTCTCTCCTCTAATGCAACAGG + Intergenic
981719468 4:147787025-147787047 GCTTTCTTCTCTATTGTGAAGGG + Intronic
981871194 4:149487690-149487712 GCTTTATTCTCCACTGTGACAGG + Intergenic
982375200 4:154682378-154682400 GTTTTCTGCTCTACTGGCAGTGG - Intronic
984644120 4:182202138-182202160 GCTTTCCAGTCAACTGGAACAGG - Intronic
985384851 4:189434570-189434592 GCTTTATTCTCCACTGCGACAGG + Intergenic
989022272 5:37022168-37022190 TCTTTCTTTTCTACTCGAATTGG + Intronic
990580282 5:57161269-57161291 GCATTCTTTTCTACTGCAAAAGG - Intergenic
991970636 5:72137775-72137797 GGTTACTTCTCTACTTAAACGGG - Intronic
992432167 5:76719696-76719718 GGTTACTTCTCTACTGTAAGAGG - Intronic
992656578 5:78916321-78916343 CCTTTCTTCTGGACTGGAACAGG - Intronic
993061488 5:83043973-83043995 GCTTTCTTCTCTACAAAAATAGG + Intergenic
993596550 5:89863801-89863823 TGTTTCTTCTCTTCTGGTACAGG - Intergenic
995962737 5:117863161-117863183 GCTATCTTCTCAACTGGAAAGGG - Intergenic
996423115 5:123284155-123284177 GCTTTCTGCTCTATTGGAACTGG + Intergenic
997012775 5:129898370-129898392 ACTCTACTCTCTACTGGAACTGG + Intergenic
998063255 5:139135655-139135677 GTATTCTTCTCTACTGGAGTGGG - Intronic
1002343947 5:178535333-178535355 GCTTCCTTATCTACTCCAACAGG + Intronic
1002512248 5:179728841-179728863 GTTTTCTTTTCTACAGAAACAGG - Exonic
1003217307 6:4126159-4126181 GCTTTCTCCTCTACTCCACCAGG + Exonic
1003750263 6:9047609-9047631 GGTTTCATCTGTATTGGAACTGG + Intergenic
1004964840 6:20836745-20836767 GCTCTTTTCTTTATTGGAACAGG - Intronic
1005045129 6:21634796-21634818 GCTTTCCTCTTTAATGGAGCAGG - Intergenic
1006921615 6:37631369-37631391 CCTTTCTTTTCTAATGGAAGAGG - Exonic
1007138133 6:39542794-39542816 GCTTTCTACTCTTCAGGAGCAGG - Intronic
1007330140 6:41100768-41100790 GCTGTCTTTTCTACTGGAAACGG - Intergenic
1007590174 6:43016303-43016325 TCTCTCTTTTCTACTGGAAATGG + Intronic
1009055839 6:58334080-58334102 GCTTTCTGACCTACAGGAACTGG + Intergenic
1011006805 6:82654623-82654645 TTTCTCTTCTCTATTGGAACTGG - Intergenic
1012807203 6:103909121-103909143 GCTTTATTCTCTGCTGTGACAGG + Intergenic
1017946955 6:159103869-159103891 GCCTTCCTCTCTTCTGGATCTGG + Intergenic
1018849071 6:167574837-167574859 GCTTTCCTCTCGCCTGGCACAGG - Intergenic
1020804601 7:12772879-12772901 GCTAGCTTCTTTACTGGAACTGG + Intergenic
1022664799 7:32400593-32400615 GTTTTCTTTTCTCCTGGAGCTGG + Intergenic
1028383509 7:90225791-90225813 GCTTTATTCTCAAGTTGAACTGG - Intronic
1029471460 7:100757299-100757321 ACTTTCTACTCTGCTGGCACTGG + Intronic
1029597202 7:101544148-101544170 GCTTTCTTCTCTACTGGAACAGG + Intronic
1031098368 7:117448239-117448261 GCTTTATTCTCTGCTGTGACAGG - Intergenic
1033026733 7:137781619-137781641 GCTTTCTTCCCTCCTCCAACAGG - Intronic
1034473983 7:151272261-151272283 GCTTGCTTCTCTGCTGGCATCGG + Intronic
1034852903 7:154512924-154512946 GCTTTCTTACCTGCAGGAACAGG + Intronic
1035777083 8:2196387-2196409 GCTTTCTTCTCTCCTGGCCAGGG - Intergenic
1037712135 8:21363058-21363080 GCATCCTTCTCCACTGCAACTGG - Intergenic
1037922789 8:22819406-22819428 CCTTTCTACTCCACTGAAACTGG - Intronic
1040511623 8:48100895-48100917 GCTTTCTTTTCTGCTATAACAGG + Intergenic
1041903031 8:63002744-63002766 CCTTTCTTCTCCACTGGACTGGG - Intergenic
1046548536 8:115682738-115682760 GATTTCTTCTCAACTAGCACAGG + Intronic
1049769289 8:144372444-144372466 CCTTTCCTCTGTAATGGAACAGG - Intergenic
1050209888 9:3241426-3241448 GCTTTCTTCCCTGCTGGCTCTGG - Intronic
1051273317 9:15375646-15375668 CCTTTCATCTCCACTGGAGCAGG + Intergenic
1051905146 9:22086292-22086314 GCTTTATTCTCTACTCCAAAAGG - Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1052088792 9:24300878-24300900 GCTTTCTTTTCTACTACAATAGG - Intergenic
1055017223 9:71631922-71631944 GCTTTCTTCTCTACTTCATTAGG - Intergenic
1055910968 9:81350694-81350716 GCTTTATTCTCCACTGTGACAGG - Intergenic
1056236959 9:84604209-84604231 ACATTCTTCTATACTGCAACTGG - Intergenic
1056567016 9:87782700-87782722 CCTCTCTTCTCTAGTGGAATTGG - Intergenic
1058123876 9:101169534-101169556 GCTTTCTTCTCAACTGCTTCAGG + Intronic
1058422584 9:104846708-104846730 TCATTCATCTCTTCTGGAACGGG + Intronic
1059930178 9:119252795-119252817 TCATTCTTCTGTACTGGTACTGG - Intronic
1060328589 9:122643350-122643372 GCTTTATTCTCTGCTGTGACAGG - Intergenic
1203524848 Un_GL000213v1:78169-78191 GTTTTCATCTCTACCGGAAGTGG - Intergenic
1185804005 X:3040320-3040342 GGTTTCTCCTCCAGTGGAACCGG + Intergenic
1187991446 X:24877845-24877867 GATTTCTTCTCTTCTGAATCTGG + Intronic
1188015469 X:25103527-25103549 GATTTCCTCTCTCCTGGAACTGG - Intergenic
1188837353 X:34974878-34974900 CCTTTCTTCTCTAATGCATCAGG - Intergenic
1188908070 X:35812110-35812132 GCTTTCCTCTCTATTAGAACAGG - Intergenic
1189603232 X:42649086-42649108 TCTATCATCTCCACTGGAACAGG + Intergenic
1189884962 X:45533170-45533192 GCTTTGTTCTCCACTGTGACAGG - Intergenic
1190804688 X:53824284-53824306 GCTTTATTCTCTGCTACAACAGG - Intergenic
1191694255 X:63972502-63972524 GATTTCCTCTATACTGGATCTGG - Intergenic
1192256812 X:69468418-69468440 GCTTACTTCTTTATTAGAACAGG - Intergenic
1194842075 X:98754774-98754796 GCTTTGCTCTCCACTGTAACAGG + Intergenic
1195024354 X:100861342-100861364 GCTTAGTTCTCATCTGGAACAGG - Intronic
1197551285 X:127895848-127895870 GCTCTCTTTACTACTGGAAACGG - Intergenic
1198263157 X:134984497-134984519 GTATTCTTCTCTAGTGAAACAGG + Intergenic
1199343458 X:146709517-146709539 GCATTCTTCTCCCCAGGAACTGG + Intergenic
1199348780 X:146774926-146774948 GTTTTCTTCTCCACTCAAACAGG + Intergenic