ID: 1029599661

View in Genome Browser
Species Human (GRCh38)
Location 7:101556243-101556265
Sequence TTGTCCCTATGGTGACATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029599652_1029599661 26 Left 1029599652 7:101556194-101556216 CCTGCTCAAAGATCTCGGCCTCT No data
Right 1029599661 7:101556243-101556265 TTGTCCCTATGGTGACATAGGGG No data
1029599653_1029599661 8 Left 1029599653 7:101556212-101556234 CCTCTGTGAAGCCTTCTCTGAAC No data
Right 1029599661 7:101556243-101556265 TTGTCCCTATGGTGACATAGGGG No data
1029599654_1029599661 -3 Left 1029599654 7:101556223-101556245 CCTTCTCTGAACCCTCCTCTTTG 0: 1
1: 0
2: 0
3: 48
4: 460
Right 1029599661 7:101556243-101556265 TTGTCCCTATGGTGACATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029599661 Original CRISPR TTGTCCCTATGGTGACATAG GGG Intronic