ID: 1029600252

View in Genome Browser
Species Human (GRCh38)
Location 7:101559112-101559134
Sequence GCCAGGCCCGGGGTGACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029600245_1029600252 8 Left 1029600245 7:101559081-101559103 CCAGGTGCCAGGGAAGCTGTGAG 0: 1
1: 0
2: 4
3: 36
4: 475
Right 1029600252 7:101559112-101559134 GCCAGGCCCGGGGTGACCACAGG 0: 1
1: 0
2: 1
3: 16
4: 238
1029600244_1029600252 12 Left 1029600244 7:101559077-101559099 CCGGCCAGGTGCCAGGGAAGCTG 0: 1
1: 0
2: 2
3: 44
4: 434
Right 1029600252 7:101559112-101559134 GCCAGGCCCGGGGTGACCACAGG 0: 1
1: 0
2: 1
3: 16
4: 238
1029600246_1029600252 1 Left 1029600246 7:101559088-101559110 CCAGGGAAGCTGTGAGCAGCTCC 0: 1
1: 0
2: 1
3: 33
4: 312
Right 1029600252 7:101559112-101559134 GCCAGGCCCGGGGTGACCACAGG 0: 1
1: 0
2: 1
3: 16
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029600252 Original CRISPR GCCAGGCCCGGGGTGACCAC AGG Intergenic
901456859 1:9368027-9368049 GCCCGGCCCAGGGTGCCCAGCGG + Exonic
901760257 1:11466549-11466571 GCCAGGGCCGGGGCTGCCACTGG - Intergenic
902311584 1:15585183-15585205 GTCAGGCTGGGGGTGCCCACTGG + Intronic
902606844 1:17573701-17573723 GCCAGGCCAGAGGGGACCCCTGG - Intronic
903314723 1:22493652-22493674 CCCATGCCCTGGGTAACCACTGG + Intronic
904598858 1:31662909-31662931 GCCAGCCCCTGGGTCAGCACTGG - Intronic
905589821 1:39153600-39153622 CCCAGGCCTGGGGTGGCCACAGG + Intronic
906142099 1:43539965-43539987 ACAAGGCCCAGGGTGCCCACAGG + Intronic
906731976 1:48090146-48090168 GCCGGGCCCTGGGTGGGCACAGG - Intergenic
912861770 1:113219833-113219855 TCCAGGCCCAGAGTGACCACAGG + Intergenic
914338752 1:146740189-146740211 GCCAGCCCCGGGCTGCCCACTGG + Intergenic
915146109 1:153796568-153796590 GCCAGGCCCAGTGTGGGCACTGG + Intergenic
915563118 1:156699200-156699222 GCCAGGCCTGGGGTCACCCATGG + Intergenic
915584489 1:156836970-156836992 GCGAGGGGTGGGGTGACCACTGG - Intronic
919943936 1:202306604-202306626 GCCAGGCCCAGTGGGAACACTGG + Intronic
922762562 1:228141805-228141827 GCCAGGCACGTGGTCTCCACAGG - Intronic
1067395234 10:45909636-45909658 GGCAGGCTCTGGGTGACCAGAGG + Intergenic
1067734276 10:48837341-48837363 GCCAGGTCAGGGGGTACCACAGG + Intronic
1067853309 10:49769002-49769024 GCCAGGCCCGCGCCCACCACAGG + Intergenic
1067863556 10:49878760-49878782 GGCAGGCTCTGGGTGACCAGAGG + Intronic
1067947695 10:50700810-50700832 GCCAGCCCCGTGCTGGCCACAGG + Intergenic
1070795061 10:79211490-79211512 GCAATCCCCGGGGTGACCTCTGG + Intronic
1071525357 10:86355100-86355122 GCCCAGCCCAGGGTGAGCACAGG - Intronic
1072207295 10:93215605-93215627 GCCAGGGCCAGGGTGACAATGGG - Intergenic
1072665498 10:97389646-97389668 GCCAGGCCTGTGGGGAACACTGG + Intronic
1074254670 10:111789125-111789147 GCCATTCCCGGGGTGACAAGTGG + Intergenic
1075567044 10:123512390-123512412 GCCAGGCGCTGGGTGGGCACTGG - Intergenic
1076380078 10:130018983-130019005 GCCAGGACAGGGTGGACCACTGG + Intergenic
1076909484 10:133379852-133379874 GCCCTGCCCTGGGGGACCACAGG + Intronic
1076994896 11:293081-293103 GCCAGCCCCACGCTGACCACCGG + Intronic
1077235794 11:1481443-1481465 ACCAGGCCTGGGGAGGCCACAGG + Intronic
1077361861 11:2144388-2144410 GGCAGGCCGGAGGTGGCCACCGG - Intronic
1077364251 11:2155169-2155191 GCCAAGCCCTGGGGGTCCACAGG - Intronic
1077408886 11:2394482-2394504 GCCAGGCCTGGGCTTCCCACAGG - Intronic
1078916156 11:15780750-15780772 GCAAGGTCCTGGGCGACCACAGG - Intergenic
1081567601 11:44269683-44269705 TCCAGGCCCTGGCTGCCCACTGG + Intronic
1082783554 11:57304197-57304219 GCCAGGCCCCAGGTTCCCACTGG + Intronic
1083949310 11:65945348-65945370 GCCAGGCCGGGGGGCAGCACAGG + Intergenic
1084195390 11:67521639-67521661 GCCTGGCCCTGGCTGAGCACTGG - Intronic
1084622301 11:70281298-70281320 GTCAGGGCCTGGGTGACCAGAGG + Intronic
1085239394 11:75040029-75040051 ACCAGGCCCAGGGTGCACACCGG - Intergenic
1085476946 11:76794891-76794913 GCCAGCCCCGGCCAGACCACAGG + Intronic
1086085070 11:82945521-82945543 GCCAGGCTCAGGGAGACGACAGG - Intronic
1088746657 11:112809685-112809707 GCCAGGCCTGGGGAGACCAGAGG + Intergenic
1088810205 11:113387148-113387170 CCCAGCCTCGGGGTGGCCACGGG - Intergenic
1088824681 11:113483731-113483753 GACAGGGCTGGGGTGACCAGTGG - Intergenic
1089132231 11:116221722-116221744 TCCAAGCCAGGGGTGAACACGGG + Intergenic
1089520105 11:119057428-119057450 GCCGGCCCCGGGGCGACCGCGGG + Intergenic
1092217999 12:6695715-6695737 GCGAGGCTGGGGGTGACCACTGG - Intronic
1096186747 12:49586600-49586622 GCCAGGCCCCAGTTGACCACTGG + Intronic
1097054634 12:56242319-56242341 GCCAGGGCAGGAATGACCACAGG + Exonic
1101967638 12:109292036-109292058 CTCAGGCCCTGGGAGACCACGGG + Intronic
1102539858 12:113610752-113610774 GCCAGGCCAGGGGAGACCCGTGG + Intergenic
1102736341 12:115163925-115163947 GCCAGGCCCGGGGAGATTAGCGG - Intergenic
1104015661 12:124960102-124960124 GCCATCCCCTGGGTGTCCACGGG + Intronic
1112344213 13:98576899-98576921 GCCAGGGCTGGGGTGGCCTCGGG - Intronic
1113854802 13:113437287-113437309 CCCAGGCGCAGGGTGAACACAGG + Intronic
1113854823 13:113437371-113437393 CCCAGGCGCAGGGTGAACACAGG + Intronic
1116253944 14:42525352-42525374 GCCAGGACCAGACTGACCACTGG - Intergenic
1116869970 14:50061325-50061347 GCCAGGCCCAGGCTGGCCCCAGG - Intergenic
1119781371 14:77278538-77278560 GCCAGGCAGGGGGTGACTTCTGG + Intronic
1121014259 14:90538852-90538874 GCCGGGCCCCGGGTCACCGCTGG - Exonic
1121120866 14:91375158-91375180 GCCAGGCCCTGGGAGAGCCCTGG - Intronic
1121740911 14:96251824-96251846 GCCAGGCCCTGTGTGGGCACAGG - Intronic
1122092323 14:99348816-99348838 GCCAGGCACGGGGTGGGCAGAGG - Intergenic
1122151243 14:99727243-99727265 GCCGGGCCCTGGGTGGGCACAGG - Exonic
1122922788 14:104886860-104886882 GCCGGGCGCTGGGGGACCACTGG - Exonic
1122953054 14:105056482-105056504 GCAAGACCCGGGGTGGCCAGAGG + Intronic
1122967719 14:105139060-105139082 GCCAGAGTAGGGGTGACCACCGG + Intergenic
1123964197 15:25438946-25438968 GCTGGGCTCGGGGTGACTACAGG - Exonic
1124042721 15:26119806-26119828 GCAGGACCCCGGGTGACCACGGG + Intergenic
1124226721 15:27901431-27901453 GCCAGGCCACAGGTGATCACAGG + Intronic
1124368475 15:29090273-29090295 CCCAGGCAGGGGGTCACCACTGG - Intronic
1128521106 15:68375477-68375499 GGCAGCCCCGGGGTCCCCACTGG - Intronic
1131175061 15:90204148-90204170 GGCAGGCTCGTGGTGACCATGGG + Intronic
1132227229 15:100151715-100151737 GCCAGGGCCAGGTGGACCACAGG + Intronic
1132631102 16:917856-917878 GCTTGGCTCTGGGTGACCACAGG - Intronic
1132994749 16:2817202-2817224 GCCGGGCCCGGGGCGCCCCCTGG - Intronic
1134254707 16:12601540-12601562 GCCAGGCACGAAGTGACGACGGG - Intergenic
1135571103 16:23549903-23549925 GCCAGCCCCGTGGTGACCTGGGG - Intronic
1136074438 16:27807189-27807211 GCCAGGCCTGGGTTAGCCACTGG - Intronic
1136294182 16:29292243-29292265 GCCAGGTCCACGCTGACCACAGG + Intergenic
1137468518 16:48733077-48733099 GCCAGGCTCTGGGTGACCTTGGG + Intergenic
1137675493 16:50301898-50301920 GCCAGACCCTGGGGGACCAAGGG + Intronic
1138457206 16:57128016-57128038 GCGTGGCCTGGGGTGAACACAGG - Intronic
1139995525 16:70977165-70977187 GCCAGCCCCGGGCTGCCCACTGG - Intronic
1140469414 16:75206027-75206049 GCCAGGCTGGGGGTGCCCCCGGG - Intronic
1140472370 16:75222912-75222934 GCCAGGCTGGGGGTGCCCCCGGG + Intronic
1142100087 16:88266289-88266311 GCCAGGTCCACGCTGACCACAGG + Intergenic
1142238008 16:88931722-88931744 CCCAGGACTGGGGTGACCAGAGG - Intronic
1142273004 16:89100814-89100836 GCCAGGGCACGGGTGAACACCGG - Exonic
1142672010 17:1491713-1491735 GCCCTGCCCGGGATGACGACAGG - Intronic
1143451033 17:7036762-7036784 CCCAGGCCCGTGGTGATGACTGG + Exonic
1144738156 17:17566411-17566433 GCCAGGCCCGGGACATCCACAGG + Intronic
1144786552 17:17835517-17835539 GCCAACCCCAGGGTGGCCACGGG + Intronic
1144945812 17:18968977-18968999 GCCACTCCCTGGGTGACCTCGGG - Exonic
1144979188 17:19158205-19158227 GCCAGGCCCGGGGAGAGCCTAGG - Exonic
1144989034 17:19220027-19220049 GCCAGGCCCGGGGAGAGCCTAGG + Exonic
1145235077 17:21202492-21202514 TCCAGGACCGGGGTTTCCACTGG - Intronic
1145294397 17:21576258-21576280 AACAGGCCCTGGGTGGCCACTGG - Intergenic
1145369435 17:22296922-22296944 AACAGGCCCTGGGTGGCCACTGG + Intergenic
1145396891 17:22503491-22503513 CCCAGGCATGAGGTGACCACAGG + Intergenic
1147510463 17:41064791-41064813 GCCAAGCCCAGAATGACCACTGG - Intergenic
1148355710 17:46974267-46974289 GCCAGGCACTGGGTGAGCAACGG - Intronic
1152027466 17:77821178-77821200 ACCAGGCTCTGGGTGACCTCTGG + Intergenic
1152296695 17:79471480-79471502 CTCAGGCCAGGGGTGACCAGAGG - Intronic
1152862551 17:82704387-82704409 TCCAGGGCGGGGCTGACCACAGG + Intergenic
1154009952 18:10565705-10565727 GCCAAGCCCACTGTGACCACTGG + Intergenic
1155035215 18:22020209-22020231 GACAGGCCTGAGGTCACCACTGG + Intergenic
1157006301 18:43588968-43588990 GCCAGGCACAGAGTGACCAGGGG + Intergenic
1158606184 18:58898489-58898511 GCAAGGACCTGGGTGAACACAGG - Intronic
1160394210 18:78559828-78559850 GCCAGGCCAGGGTTCATCACAGG + Intergenic
1160580956 18:79884409-79884431 GCCAGGCCGGGGTTGAGCAGAGG - Intronic
1160662319 19:306833-306855 GCCGGGCCCGGGGTGCCCTGAGG + Intronic
1160707188 19:535180-535202 TCCAGGGCCTGGGTGACCACAGG + Intronic
1160800406 19:965008-965030 GCCAGGCCCAGGGAGGACACGGG - Exonic
1160844289 19:1159722-1159744 GCAAGGGACGGGGTGACAACAGG + Intronic
1160855485 19:1215341-1215363 ACCAGGCCTGCGGTGACCAGTGG + Intronic
1161380840 19:3964209-3964231 CCCAGGCCGGGGCTGCCCACTGG + Intronic
1161545482 19:4877944-4877966 GCCTGGCCCGGGGTCCCCTCGGG - Intergenic
1161709942 19:5842066-5842088 CTCAGGCCCGGGGTCACCAGAGG + Intergenic
1161718923 19:5892637-5892659 CCCAGCCCCGCGGTGACCACAGG - Exonic
1162377995 19:10316358-10316380 GCAAGGCCCAGGGTCACCTCAGG + Exonic
1162794213 19:13078329-13078351 GCCAGGCAGGGGGTGAGCAAGGG - Intronic
1163417424 19:17195143-17195165 GCCAGGCCTGGGGCTCCCACTGG - Exonic
1163782482 19:19257747-19257769 GCCAGGCTCCAGGGGACCACAGG + Exonic
1164147282 19:22519756-22519778 GCAAGGCCGCGGCTGACCACCGG + Intronic
1164159318 19:22616354-22616376 GCAAGGCCGCGGCTGACCACCGG - Intergenic
1164706862 19:30326232-30326254 GCCAAGCCCGGGCTGACCACTGG - Intronic
1165121248 19:33560215-33560237 GCCAGGCCCGGGGCAGCCTCAGG + Intergenic
1165135696 19:33667033-33667055 GCCAGCCCCTGTGTGATCACAGG + Intronic
1165284656 19:34831990-34832012 GCCAGACCCGGTGTGGCCAATGG + Intergenic
1167391289 19:49196751-49196773 GCCAGGCCCGGGGCCCCCGCTGG - Exonic
1167448871 19:49555855-49555877 GCCGGCCCGGGGGTGACCAGTGG + Intronic
1167526233 19:49985585-49985607 GCCAGGTCCTGGGTGTCCACTGG - Intronic
1168057965 19:53874007-53874029 GCCCGGCCCGGCGAGATCACTGG + Exonic
926800632 2:16656994-16657016 GCCAGCCCCAGGCTGACCTCTGG - Intronic
929441963 2:41971724-41971746 TCCAGGCCTGAGGTGACCTCTGG - Intergenic
929567814 2:43000651-43000673 GCCAGGCCCAGGGGGACAATGGG + Intergenic
931744831 2:65282739-65282761 CCCAGGCCTGTGGTGACCCCTGG - Intergenic
937476229 2:122217886-122217908 GCCAGGGCTGAGGTGGCCACAGG - Intergenic
937773062 2:125744896-125744918 GCCTGTCTCGGGGTGAGCACTGG - Intergenic
937921845 2:127136710-127136732 GACAGGGCTGGGGTGACCAAGGG + Intergenic
942248240 2:174026346-174026368 GCTAGGCCCTGGCTGCCCACAGG - Intergenic
947500519 2:230667838-230667860 GCTAGGCAATGGGTGACCACTGG - Intergenic
948660865 2:239505765-239505787 CCCATGCCCAGGGTGACCATGGG + Intergenic
948695581 2:239731659-239731681 GCCAGGCTCCTGGTGGCCACTGG + Intergenic
1170438127 20:16350872-16350894 GTCAGGCACGGGGTGGGCACTGG + Intronic
1170600618 20:17838761-17838783 TCCAAGCCAGGGGTGATCACAGG - Intergenic
1171143479 20:22762823-22762845 GCCCAGCCGGGGGTGACCCCAGG - Intergenic
1171293369 20:23995194-23995216 GCCAGGACAGGGGAGCCCACCGG + Intergenic
1171967553 20:31542033-31542055 GCCAGTCCTTGGGAGACCACAGG - Intronic
1173335846 20:42111981-42112003 GTCAGGCCATGGGAGACCACAGG + Intronic
1175530351 20:59670643-59670665 GCAAGGTCCGGGGAGACCCCAGG + Intronic
1179480371 21:41673055-41673077 CCCAGGGCCGGGGCCACCACAGG + Intergenic
1179605312 21:42512500-42512522 GCCAGGGCTGGGGAGACCATTGG + Intronic
1179954027 21:44727916-44727938 GCCAGGCCCTGGGAGCCCAGGGG - Intergenic
1180086978 21:45512075-45512097 GCCAGCCCTGGGGTTACCAGGGG - Intronic
1180093343 21:45543296-45543318 GCCAGGCCCTGGGTAACTCCAGG - Intronic
1180096352 21:45557037-45557059 GCCAGGCCAGGGCTGAGCCCAGG - Intergenic
1180488559 22:15821531-15821553 GCCCGGCGGGGGGTGACCCCGGG + Intergenic
1180801185 22:18632688-18632710 GCCAGGCCCGGGTGGGCCCCAGG - Intergenic
1180852414 22:19028247-19028269 GCCAGGCCCGGGTGGGCCCCAGG - Intergenic
1181124854 22:20696065-20696087 GCCAGGACAGGGGAGCCCACTGG + Intergenic
1181220536 22:21362573-21362595 GCCAGGCCCGGGTGGGCCCCAGG + Intergenic
1181404201 22:22670587-22670609 GGCAGGCCAGGGGTGGCCACAGG + Intergenic
1181412792 22:22736174-22736196 GTCAGGCCAGGAGTGGCCACAGG + Intronic
1181416139 22:22760292-22760314 GTCAGGCCAGGGATGGCCACAGG + Intronic
1182468387 22:30532151-30532173 GCCAGGACCGGAGTGACCCAAGG + Intronic
1182522203 22:30891033-30891055 GCCAGGCCCAAGGTGACAAATGG + Intronic
1183207972 22:36432592-36432614 GCCAGTCCCCAGGTGACCCCCGG + Intergenic
1183324532 22:37184190-37184212 GCCAGGTGCCAGGTGACCACTGG + Intronic
1184331809 22:43832478-43832500 ACCTGGCCCGTGCTGACCACAGG + Intronic
1184478685 22:44735186-44735208 GCTGGGGCAGGGGTGACCACGGG + Intronic
1184614925 22:45631517-45631539 ACCAGGCCCAGGGTGCCCAGGGG + Intergenic
1184688566 22:46107345-46107367 GCCAAGCCCGAGGTGACTTCGGG + Intronic
1185008620 22:48300303-48300325 GCCAGGCCTGGGGCAGCCACTGG + Intergenic
1185329726 22:50246812-50246834 GCCAGGATAGGGGTGCCCACAGG + Intronic
1185367780 22:50444877-50444899 GCCTGGCAGGGGGAGACCACAGG + Intronic
1185414783 22:50704078-50704100 GTCAGTCCCGGGGTGACTGCAGG + Intergenic
1203274567 22_KI270734v1_random:78815-78837 GCCAGGACAGGGGAGCCCACTGG + Intergenic
950095730 3:10329171-10329193 GCCAGGCTCGGGGGGCTCACAGG + Intronic
950449873 3:13059442-13059464 GCCTGGCACGGGGTGCCCTCTGG + Intronic
950713836 3:14833686-14833708 GAGAGGCCCGAGGTGACCAGAGG + Intronic
953970335 3:47342333-47342355 GCCAGGACTTGGGGGACCACAGG + Intronic
954575152 3:51671704-51671726 GCAAGGCCCGGGGTGAGCAGGGG + Exonic
954626728 3:52025907-52025929 GACAGGCATGGGGAGACCACAGG + Intergenic
955325032 3:58003351-58003373 CCCAGGCTTGGGGAGACCACGGG + Intergenic
960987518 3:123290460-123290482 CCCAGGCCCGGCGTGCCCGCTGG + Intronic
961371305 3:126433618-126433640 CCCATGCCCGGGGTGGCCCCAGG - Intronic
961603415 3:128077087-128077109 GCCCGGCCCGCGCTGACCCCCGG - Intronic
961658815 3:128457642-128457664 GCCAGGCAGGGGTTGCCCACTGG - Intergenic
968552710 4:1231888-1231910 GCCAGGCCAGGGGTTACCGGCGG + Intronic
968648518 4:1751390-1751412 GCCAGGCCCAGCCCGACCACTGG - Intergenic
968657588 4:1785377-1785399 CCCAGGCCCGGGGTTATCTCAGG - Intergenic
968702106 4:2062109-2062131 GCCATGCCCCGTGTGCCCACCGG - Intronic
969290085 4:6233283-6233305 TCCAGACCCGAGGTGGCCACAGG - Intergenic
979134024 4:117085636-117085658 GCCAGGCCCGGGGTTGCGAGCGG + Intergenic
985622645 5:963512-963534 GCCAGGCCCGGGGCTGTCACGGG - Intergenic
988641149 5:33041816-33041838 GCCAGGCCCGGAGAGGCCACTGG - Intergenic
989523035 5:42423610-42423632 GCCAGGCGCGGCGTGACCCCTGG + Intergenic
993932393 5:93955810-93955832 TCCAGGCCCAGAGTGAGCACAGG - Intronic
995748699 5:115431029-115431051 GCCAGGCCAGCAGTGGCCACGGG - Intergenic
998007299 5:138665513-138665535 GCCAGGCCCTGGGTGCCTCCCGG - Intronic
999373120 5:151068276-151068298 GGCAGTCCCTGGATGACCACTGG + Intronic
1002061939 5:176630347-176630369 GCCAGGCCGGGGTGGACCAGGGG + Exonic
1002180039 5:177426645-177426667 GCCAGCGCCGGGGTGGCCCCCGG + Intronic
1002198141 5:177512253-177512275 GCCAGAACCTGGGTGGCCACAGG + Intronic
1002438508 5:179250691-179250713 GCAAGGCCCTGGGAGGCCACTGG + Intronic
1002986011 6:2191185-2191207 GCCCCGCATGGGGTGACCACCGG + Intronic
1006426045 6:33963550-33963572 CCCTGGCCCGTGGAGACCACAGG - Intergenic
1007697642 6:43743942-43743964 GCTGGGCCTGGGGTGAGCACTGG - Intergenic
1010369466 6:75090209-75090231 GCCAGGCCCGCCGGGTCCACCGG - Exonic
1018768901 6:166955798-166955820 GCACGCCCCGGGGTGACCTCTGG - Intronic
1019257728 7:62477-62499 GCCAGGCCCACGGGGATCACAGG + Intergenic
1019322036 7:420201-420223 GCCAGGCCTGGGGCCACCAGGGG - Intergenic
1019381662 7:727313-727335 GCGGGGCCCGGGGTGCTCACCGG - Exonic
1019430329 7:996173-996195 GCCAGGCCAGCAGTGGCCACGGG + Intergenic
1019509960 7:1412874-1412896 GCCAGACGCGGGGTGCGCACCGG - Intergenic
1020309846 7:6859383-6859405 TCCAGCCCCGGAGTGTCCACAGG + Intergenic
1022530056 7:31061410-31061432 GCCACGCCCCTGGTGGCCACAGG - Intronic
1023409071 7:39870104-39870126 TCCAGGCCCTGGGTAACCACCGG - Intergenic
1024046502 7:45589234-45589256 GCCAGGCCCTGGGTGGCACCAGG - Intronic
1024306283 7:47932199-47932221 GTCAGGCCCAGGCTGACCATGGG + Intronic
1024306761 7:47935685-47935707 ACCATGCCCTGGGAGACCACGGG - Intronic
1024709957 7:52004437-52004459 GTCAGGACAGGGGAGACCACAGG - Intergenic
1026579035 7:71598736-71598758 GCCAGGCCTGGGGTAATCAGAGG + Intronic
1026947929 7:74328079-74328101 GCTGGGCCTGGGGTGACCACAGG + Intronic
1029159436 7:98541176-98541198 GGCAGGCACGGTGAGACCACAGG - Intergenic
1029595491 7:101535518-101535540 GTCAGGGCCGGGAAGACCACAGG - Intronic
1029600252 7:101559112-101559134 GCCAGGCCCGGGGTGACCACAGG + Intergenic
1031029262 7:116716824-116716846 GCCAGCCACGGGCTGAGCACTGG - Intronic
1035594365 8:843512-843534 GCCAGGCCCGGTGGAACCCCAGG - Intergenic
1039512812 8:38105350-38105372 GCCAGGCCCGCGGCCACCGCCGG + Exonic
1045892199 8:107170334-107170356 ACCAGGCCCAGGGTGCACACTGG + Intergenic
1046844849 8:118904197-118904219 GCCAAGCTCGGGCTGCCCACGGG - Intergenic
1049241831 8:141541722-141541744 GCCAGGCCTGGCGTGTCCTCAGG - Intergenic
1049788495 8:144462545-144462567 GCCGGGCCCGGGGCGGCCGCCGG - Intronic
1051353297 9:16218316-16218338 GCCAGCCCAGGGGAGACCCCGGG - Intronic
1053297843 9:36927630-36927652 GCCAGGCCCTGGGGGACGGCGGG + Intronic
1057188468 9:93072347-93072369 GCCAGGGGCAGGGGGACCACTGG + Intronic
1057222531 9:93264951-93264973 GCCAGGGCAGGGGTGGCCAGGGG - Intronic
1059277658 9:113109389-113109411 GACAAGCCCCGGGTGAGCACAGG + Intergenic
1059278593 9:113115162-113115184 GACAAGCCCCGGGTGAGCACAGG - Intergenic
1059640472 9:116211846-116211868 TCCTGGCCCTGGGTCACCACAGG - Exonic
1060855027 9:126908258-126908280 GCCTGGCCCCGGGTGACAATGGG - Intergenic
1061498753 9:130990449-130990471 GCGAGGCCCGTGGTGGTCACTGG - Intergenic
1062005849 9:134238035-134238057 TCCAGGCTCGTGGCGACCACTGG - Intergenic
1062033619 9:134373001-134373023 CCCAGGCCAGGCTTGACCACAGG - Intronic
1062426683 9:136509224-136509246 GCCGGGCCCCGGGTTCCCACTGG - Intronic
1062641648 9:137521729-137521751 GCCAGCTGCGCGGTGACCACCGG + Intronic
1186480796 X:9895054-9895076 GGGAGGCCCGGGCTGCCCACAGG + Exonic
1190055757 X:47180158-47180180 GTCAGGCCCGGGGAGGCCCCCGG - Intronic
1198283887 X:135171176-135171198 CCCAGGCCGGTGGTGACAACTGG - Exonic
1199599737 X:149534827-149534849 TGCAGGCCAGGGCTGACCACAGG + Intergenic
1200090276 X:153632758-153632780 GCCAGGGCCAGGCTGGCCACAGG - Intergenic