ID: 1029603073

View in Genome Browser
Species Human (GRCh38)
Location 7:101581308-101581330
Sequence TGTAAAATTGATCTCTTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029603073_1029603082 19 Left 1029603073 7:101581308-101581330 CCGCCCAAGAGATCAATTTTACA No data
Right 1029603082 7:101581350-101581372 TACATGGCAATGGGATCCATTGG No data
1029603073_1029603078 3 Left 1029603073 7:101581308-101581330 CCGCCCAAGAGATCAATTTTACA No data
Right 1029603078 7:101581334-101581356 AAAGGTCCACAATGGATACATGG No data
1029603073_1029603081 10 Left 1029603073 7:101581308-101581330 CCGCCCAAGAGATCAATTTTACA No data
Right 1029603081 7:101581341-101581363 CACAATGGATACATGGCAATGGG No data
1029603073_1029603080 9 Left 1029603073 7:101581308-101581330 CCGCCCAAGAGATCAATTTTACA No data
Right 1029603080 7:101581340-101581362 CCACAATGGATACATGGCAATGG No data
1029603073_1029603077 -5 Left 1029603073 7:101581308-101581330 CCGCCCAAGAGATCAATTTTACA No data
Right 1029603077 7:101581326-101581348 TTACAGCAAAAGGTCCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029603073 Original CRISPR TGTAAAATTGATCTCTTGGG CGG (reversed) Intergenic
No off target data available for this crispr