ID: 1029604493

View in Genome Browser
Species Human (GRCh38)
Location 7:101590418-101590440
Sequence GCACCAGGCCACCGCGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029604493_1029604507 18 Left 1029604493 7:101590418-101590440 CCACCCCCGCGGTGGCCTGGTGC No data
Right 1029604507 7:101590459-101590481 GTGAGATAATCCGGCTAGACGGG No data
1029604493_1029604500 -8 Left 1029604493 7:101590418-101590440 CCACCCCCGCGGTGGCCTGGTGC No data
Right 1029604500 7:101590433-101590455 CCTGGTGCCAGCCCTGCAGGCGG No data
1029604493_1029604501 -7 Left 1029604493 7:101590418-101590440 CCACCCCCGCGGTGGCCTGGTGC No data
Right 1029604501 7:101590434-101590456 CTGGTGCCAGCCCTGCAGGCGGG No data
1029604493_1029604506 17 Left 1029604493 7:101590418-101590440 CCACCCCCGCGGTGGCCTGGTGC No data
Right 1029604506 7:101590458-101590480 AGTGAGATAATCCGGCTAGACGG No data
1029604493_1029604505 9 Left 1029604493 7:101590418-101590440 CCACCCCCGCGGTGGCCTGGTGC No data
Right 1029604505 7:101590450-101590472 AGGCGGGCAGTGAGATAATCCGG No data
1029604493_1029604509 30 Left 1029604493 7:101590418-101590440 CCACCCCCGCGGTGGCCTGGTGC No data
Right 1029604509 7:101590471-101590493 GGCTAGACGGGCTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029604493 Original CRISPR GCACCAGGCCACCGCGGGGG TGG (reversed) Intergenic
No off target data available for this crispr