ID: 1029605890

View in Genome Browser
Species Human (GRCh38)
Location 7:101599205-101599227
Sequence TCACATGCCAAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029605890_1029605895 6 Left 1029605890 7:101599205-101599227 CCCTCTGCCCTCTTGGCATGTGA No data
Right 1029605895 7:101599234-101599256 TTCCACCCATAGAGACCAGATGG No data
1029605890_1029605901 27 Left 1029605890 7:101599205-101599227 CCCTCTGCCCTCTTGGCATGTGA No data
Right 1029605901 7:101599255-101599277 GGCAGTCTCTGGCTTTTCCAAGG No data
1029605890_1029605899 16 Left 1029605890 7:101599205-101599227 CCCTCTGCCCTCTTGGCATGTGA No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029605890 Original CRISPR TCACATGCCAAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr