ID: 1029605891

View in Genome Browser
Species Human (GRCh38)
Location 7:101599206-101599228
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029605891_1029605899 15 Left 1029605891 7:101599206-101599228 CCTCTGCCCTCTTGGCATGTGAC No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data
1029605891_1029605901 26 Left 1029605891 7:101599206-101599228 CCTCTGCCCTCTTGGCATGTGAC No data
Right 1029605901 7:101599255-101599277 GGCAGTCTCTGGCTTTTCCAAGG No data
1029605891_1029605895 5 Left 1029605891 7:101599206-101599228 CCTCTGCCCTCTTGGCATGTGAC No data
Right 1029605895 7:101599234-101599256 TTCCACCCATAGAGACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029605891 Original CRISPR GTCACATGCCAAGAGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr