ID: 1029605892

View in Genome Browser
Species Human (GRCh38)
Location 7:101599212-101599234
Sequence ACTAAGGTCACATGCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029605892_1029605901 20 Left 1029605892 7:101599212-101599234 CCCTCTTGGCATGTGACCTTAGT No data
Right 1029605901 7:101599255-101599277 GGCAGTCTCTGGCTTTTCCAAGG No data
1029605892_1029605903 29 Left 1029605892 7:101599212-101599234 CCCTCTTGGCATGTGACCTTAGT No data
Right 1029605903 7:101599264-101599286 TGGCTTTTCCAAGGACCCGCGGG No data
1029605892_1029605895 -1 Left 1029605892 7:101599212-101599234 CCCTCTTGGCATGTGACCTTAGT No data
Right 1029605895 7:101599234-101599256 TTCCACCCATAGAGACCAGATGG No data
1029605892_1029605899 9 Left 1029605892 7:101599212-101599234 CCCTCTTGGCATGTGACCTTAGT No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data
1029605892_1029605904 30 Left 1029605892 7:101599212-101599234 CCCTCTTGGCATGTGACCTTAGT No data
Right 1029605904 7:101599265-101599287 GGCTTTTCCAAGGACCCGCGGGG No data
1029605892_1029605902 28 Left 1029605892 7:101599212-101599234 CCCTCTTGGCATGTGACCTTAGT No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029605892 Original CRISPR ACTAAGGTCACATGCCAAGA GGG (reversed) Intergenic
No off target data available for this crispr