ID: 1029605894

View in Genome Browser
Species Human (GRCh38)
Location 7:101599228-101599250
Sequence GGTCTCTATGGGTGGAACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029605894_1029605899 -7 Left 1029605894 7:101599228-101599250 CCTTAGTTCCACCCATAGAGACC No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data
1029605894_1029605902 12 Left 1029605894 7:101599228-101599250 CCTTAGTTCCACCCATAGAGACC No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data
1029605894_1029605905 18 Left 1029605894 7:101599228-101599250 CCTTAGTTCCACCCATAGAGACC No data
Right 1029605905 7:101599269-101599291 TTTCCAAGGACCCGCGGGGCAGG No data
1029605894_1029605901 4 Left 1029605894 7:101599228-101599250 CCTTAGTTCCACCCATAGAGACC No data
Right 1029605901 7:101599255-101599277 GGCAGTCTCTGGCTTTTCCAAGG No data
1029605894_1029605904 14 Left 1029605894 7:101599228-101599250 CCTTAGTTCCACCCATAGAGACC No data
Right 1029605904 7:101599265-101599287 GGCTTTTCCAAGGACCCGCGGGG No data
1029605894_1029605903 13 Left 1029605894 7:101599228-101599250 CCTTAGTTCCACCCATAGAGACC No data
Right 1029605903 7:101599264-101599286 TGGCTTTTCCAAGGACCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029605894 Original CRISPR GGTCTCTATGGGTGGAACTA AGG (reversed) Intergenic
No off target data available for this crispr