ID: 1029605899

View in Genome Browser
Species Human (GRCh38)
Location 7:101599244-101599266
Sequence AGAGACCAGATGGCAGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029605892_1029605899 9 Left 1029605892 7:101599212-101599234 CCCTCTTGGCATGTGACCTTAGT No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data
1029605889_1029605899 22 Left 1029605889 7:101599199-101599221 CCACTGCCCTCTGCCCTCTTGGC No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data
1029605891_1029605899 15 Left 1029605891 7:101599206-101599228 CCTCTGCCCTCTTGGCATGTGAC No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data
1029605893_1029605899 8 Left 1029605893 7:101599213-101599235 CCTCTTGGCATGTGACCTTAGTT No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data
1029605890_1029605899 16 Left 1029605890 7:101599205-101599227 CCCTCTGCCCTCTTGGCATGTGA No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data
1029605894_1029605899 -7 Left 1029605894 7:101599228-101599250 CCTTAGTTCCACCCATAGAGACC No data
Right 1029605899 7:101599244-101599266 AGAGACCAGATGGCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029605899 Original CRISPR AGAGACCAGATGGCAGTCTC TGG Intergenic
No off target data available for this crispr