ID: 1029605902

View in Genome Browser
Species Human (GRCh38)
Location 7:101599263-101599285
Sequence CTGGCTTTTCCAAGGACCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029605893_1029605902 27 Left 1029605893 7:101599213-101599235 CCTCTTGGCATGTGACCTTAGTT No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data
1029605896_1029605902 4 Left 1029605896 7:101599236-101599258 CCACCCATAGAGACCAGATGGCA No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data
1029605892_1029605902 28 Left 1029605892 7:101599212-101599234 CCCTCTTGGCATGTGACCTTAGT No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data
1029605900_1029605902 -9 Left 1029605900 7:101599249-101599271 CCAGATGGCAGTCTCTGGCTTTT No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data
1029605898_1029605902 0 Left 1029605898 7:101599240-101599262 CCATAGAGACCAGATGGCAGTCT No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data
1029605897_1029605902 1 Left 1029605897 7:101599239-101599261 CCCATAGAGACCAGATGGCAGTC No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data
1029605894_1029605902 12 Left 1029605894 7:101599228-101599250 CCTTAGTTCCACCCATAGAGACC No data
Right 1029605902 7:101599263-101599285 CTGGCTTTTCCAAGGACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029605902 Original CRISPR CTGGCTTTTCCAAGGACCCG CGG Intergenic
No off target data available for this crispr