ID: 1029611051

View in Genome Browser
Species Human (GRCh38)
Location 7:101626752-101626774
Sequence CTGGGGAATGAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1438
Summary {0: 1, 1: 1, 2: 20, 3: 192, 4: 1224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029611051_1029611062 7 Left 1029611051 7:101626752-101626774 CCCTCCTCTTCCTCATTCCCCAG 0: 1
1: 1
2: 20
3: 192
4: 1224
Right 1029611062 7:101626782-101626804 CACAAAGTCCAGGAAAGCAGAGG No data
1029611051_1029611064 18 Left 1029611051 7:101626752-101626774 CCCTCCTCTTCCTCATTCCCCAG 0: 1
1: 1
2: 20
3: 192
4: 1224
Right 1029611064 7:101626793-101626815 GGAAAGCAGAGGCTCAAATCAGG No data
1029611051_1029611058 -3 Left 1029611051 7:101626752-101626774 CCCTCCTCTTCCTCATTCCCCAG 0: 1
1: 1
2: 20
3: 192
4: 1224
Right 1029611058 7:101626772-101626794 CAGCAGTCCCCACAAAGTCCAGG 0: 1
1: 0
2: 0
3: 21
4: 227
1029611051_1029611065 28 Left 1029611051 7:101626752-101626774 CCCTCCTCTTCCTCATTCCCCAG 0: 1
1: 1
2: 20
3: 192
4: 1224
Right 1029611065 7:101626803-101626825 GGCTCAAATCAGGACCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029611051 Original CRISPR CTGGGGAATGAGGAAGAGGA GGG (reversed) Intronic
900382744 1:2392871-2392893 CTTGGGAAGGAGGAAGAGACGGG + Intronic
900422407 1:2561254-2561276 CTGGGGCCAGAGGACGAGGAGGG - Intronic
900807996 1:4780504-4780526 CCGGGGAATGTGGAAGAGGTGGG + Intronic
900822490 1:4900040-4900062 CTGGGGAATGGGGAAGGGGCTGG + Intergenic
900915467 1:5635279-5635301 CTGGAGAAGGAGGAAAAGGGGGG - Intergenic
901203659 1:7481542-7481564 CTGGGGAGGGAGGAACAGAAGGG - Intronic
901214845 1:7549423-7549445 CGGGGGAATAAGGATGAGGGAGG - Intronic
901220806 1:7582831-7582853 CTGGGGACTGAGGAACCAGAAGG + Intronic
901263109 1:7888321-7888343 CTGAGGGATGGGGAGGAGGAAGG - Intergenic
901291449 1:8127387-8127409 CTGGGGAAGGAGGGAGATGGAGG - Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901751781 1:11414397-11414419 CTGGGGGATGAGGGATTGGAGGG + Intergenic
901841630 1:11957502-11957524 CGCTGGAATGAGGGAGAGGAAGG + Intronic
901903151 1:12384274-12384296 TGTGGGAATGAGGGAGAGGAAGG + Intronic
901910918 1:12457292-12457314 CAAGGAAATGAGGCAGAGGAGGG - Intronic
902055113 1:13594334-13594356 CTGGGCAATGAAGGAGAGGTGGG + Intronic
902078718 1:13806557-13806579 GTGGGGATGGAGGAAGAGGTTGG - Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902242755 1:15099762-15099784 CTGGGGGATGCGGAATAGAAGGG + Intronic
902295114 1:15461872-15461894 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902297979 1:15481411-15481433 CTGAGGGAGGATGAAGAGGAGGG + Intronic
902314328 1:15606508-15606530 CTGGAGAATGAGGGAGAGGGAGG - Intergenic
902563365 1:17292898-17292920 GAGGGGAATGGGGAAGGGGAGGG + Intergenic
902650059 1:17831229-17831251 CTGGGGAATGAGAGGGAGTAGGG + Intergenic
902750580 1:18506802-18506824 AAGTGGAATGAGGAAGAGGGAGG - Intergenic
902769468 1:18637262-18637284 GAGGGCAATGAGGAAGGGGAGGG - Intronic
903017691 1:20371932-20371954 TTTGATAATGAGGAAGAGGAGGG + Intergenic
903027609 1:20440851-20440873 GCGGGAAGTGAGGAAGAGGAGGG + Intergenic
903037266 1:20500969-20500991 CCGGAGAATGAAGAAGAGGGTGG + Exonic
903049087 1:20587659-20587681 ATGGGGAATGGGGAAGGGGCAGG - Intergenic
903210176 1:21813800-21813822 CTGCTGACTGAGGATGAGGATGG - Intronic
903292123 1:22320878-22320900 ATGGGGAATGAGGGAGAGGAGGG + Intergenic
903325563 1:22566877-22566899 ATGGGGACAGAGGAAGAGGAGGG + Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903735651 1:25528525-25528547 CTGGTGTATGAGGATGTGGAAGG + Intergenic
904096171 1:27979266-27979288 CTGGGAAATGAAGAATTGGAGGG - Intronic
904271975 1:29356109-29356131 CTGTGGAAGTAGGAAGAGAAGGG - Intergenic
904364655 1:30002603-30002625 CTGGGGAATAAGGAAGAAAATGG - Intergenic
904368487 1:30033779-30033801 GTGGGGAATAAGACAGAGGAGGG + Intergenic
905254614 1:36672229-36672251 CTGGGAAATGGGGAAGAAAATGG - Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905370474 1:37480123-37480145 CTGGGGAAAGGGGAAGGGGCTGG + Intronic
906187264 1:43871482-43871504 CTGGGGTGTGAGGGAGAGGATGG + Intronic
906187270 1:43871501-43871523 ATGGGGTGTGAGGGAGAGGATGG + Intronic
906187276 1:43871520-43871542 ATGGGGTGTGAGGGAGAGGATGG + Intronic
906187294 1:43871575-43871597 ATGGGGTGTGAGGGAGAGGATGG + Intronic
906187318 1:43871670-43871692 ATGGGGTGTGAGGGAGAGGATGG + Intronic
906187331 1:43871708-43871730 CTGGGGTGTGAGGGAGAGGAGGG + Intronic
906187363 1:43871819-43871841 CTGGGGTGTGAGGGAGAGGAGGG + Intronic
906187481 1:43872176-43872198 CTGGGGTGTGAGGGACAGGAGGG + Intronic
906243273 1:44255795-44255817 GTGGGCAGTAAGGAAGAGGAAGG - Intronic
906314066 1:44775176-44775198 ATGGGGATTGAGGGAGAGGGCGG - Intergenic
906372183 1:45263561-45263583 ATGGAGCATGAGGAAAAGGATGG - Intronic
906416184 1:45622668-45622690 CTAGGGAGTGGGGAACAGGAAGG + Intronic
906616265 1:47234941-47234963 TGGGGGGATGAGGGAGAGGAAGG + Intergenic
906689001 1:47780459-47780481 CTGGGTAGTGATGAAGAGGCAGG + Intronic
906795737 1:48695232-48695254 CTGGGGAACTAGGAACTGGAAGG - Intronic
907090354 1:51718559-51718581 CTGGGGAATGAAGACCAGAATGG - Intronic
907282446 1:53359934-53359956 CTGAGCAAAGAGGTAGAGGAGGG - Intergenic
907359747 1:53904894-53904916 AGGTGGAAGGAGGAAGAGGAGGG + Intronic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
908897278 1:68914442-68914464 CTGTGGAATGAGAAAGATAAGGG - Intergenic
909887803 1:80964288-80964310 GGGGGGAATGAGAAAGAGGGAGG + Intergenic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912451526 1:109770460-109770482 CAGGGCAATGAGGAAAAGGCAGG - Intronic
912469222 1:109895192-109895214 CTGGGGAGTGAGTAGGAGGTAGG - Intergenic
912491412 1:110064766-110064788 CCGGGGAAAGAGGAAGATGCAGG + Exonic
912773756 1:112490270-112490292 CTGGGGGACTTGGAAGAGGAGGG + Intronic
912933677 1:113985019-113985041 CTGGAGGAGGAGGAAAAGGAGGG - Intergenic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913502848 1:119487997-119488019 GTGGAGAAGGAGGAAGAGCAGGG + Intergenic
913703257 1:121395557-121395579 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
913939639 1:125088376-125088398 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
913979430 1:143496721-143496743 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
914043818 1:144076042-144076064 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
914073834 1:144322371-144322393 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
914105321 1:144643989-144644011 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
914134270 1:144884449-144884471 CTGGGGCATGAGGAAAAGGCAGG + Intergenic
914255551 1:145959385-145959407 ATGGGGAATGAGGAATGGGGAGG - Intergenic
914942578 1:152036296-152036318 GTGGGGTAAAAGGAAGAGGAAGG + Intronic
915286024 1:154852881-154852903 CTGGGGGAAGAGGAATAGCAAGG - Intronic
915481764 1:156191338-156191360 CTGGAGATTGAGGGAGAGGATGG - Intergenic
915840934 1:159212418-159212440 CTGGGGCTTGAGGGAGATGATGG - Intergenic
915929917 1:160053990-160054012 TTGGGGATTGAGGTGGAGGAAGG - Intronic
916126882 1:161579625-161579647 GAGGGGAAAGAGGAAGAGTATGG - Intergenic
916128017 1:161588612-161588634 CCGTGGAAGGAGGAAAAGGAAGG - Intronic
916136801 1:161661429-161661451 GAGGGGAAAGAGGAAGAGTATGG - Intronic
916137935 1:161670442-161670464 CCGTGGAAGGAGGAAAAGGAAGG - Intronic
916275473 1:162989006-162989028 ATGGGGAGTGAGGTAAAGGAAGG + Intergenic
916332085 1:163628360-163628382 AGGGGGGATGGGGAAGAGGATGG - Intergenic
916336151 1:163673164-163673186 CTGGGGAGTGAGGAGGAAAAGGG - Intergenic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
917038924 1:170780709-170780731 CTGGACATTGAGGAAGAGGGAGG + Intergenic
917345233 1:174022365-174022387 CCGGAGCCTGAGGAAGAGGAAGG - Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917457889 1:175201246-175201268 TTGGGGGATGAGGAAAAGTAGGG - Intergenic
917587529 1:176442892-176442914 CTGTGGAATGGGGAAAAGGTAGG - Intergenic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917652694 1:177094743-177094765 TTGGGTAATGAGTAAGAGGCTGG + Intronic
917735445 1:177915831-177915853 TTGGTGAATGAGTAAGAGCAAGG - Intergenic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
918072605 1:181143983-181144005 CTGGGGAATGGGGTGAAGGAGGG - Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918369516 1:183845599-183845621 CTGGGGAGTGATGAAAAGGGTGG - Intronic
919673116 1:200355827-200355849 CTGGTGAGTGAGAGAGAGGAGGG - Intergenic
920070028 1:203296129-203296151 CCTGGGAGTGAGGATGAGGAGGG + Intergenic
920380322 1:205531321-205531343 CTGGAGAATGGAGAAGAGGTGGG - Intronic
920707684 1:208266505-208266527 CTGGGAAAGGTGGGAGAGGAGGG - Intergenic
920771069 1:208886133-208886155 CTGGGGACTGAGCAATAGGAAGG + Intergenic
920879722 1:209868396-209868418 GTGGGGTGTGGGGAAGAGGAGGG - Intergenic
921808010 1:219478094-219478116 CTGGAGAATGAGGGTGGGGAGGG + Intergenic
921958084 1:221004623-221004645 CTGGGAAAAGAAGAAGAGGCAGG - Intergenic
922213499 1:223502668-223502690 CAGGGGAATGGGGAAGGGGCTGG + Intergenic
922367332 1:224878289-224878311 CTTGGGAATAAGGAGGAAGAGGG - Intergenic
922574886 1:226654937-226654959 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923368398 1:233286199-233286221 CTTCTGACTGAGGAAGAGGATGG - Intronic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
924051904 1:240087674-240087696 ATAGGGACTGGGGAAGAGGAAGG + Intronic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924258561 1:242206744-242206766 CAGGAGGAGGAGGAAGAGGATGG + Intronic
924604476 1:245521001-245521023 CTGGGGAATGCTTAAGAGGTTGG + Intronic
924645228 1:245871495-245871517 CTGGGGAATAAGGAAAAGGAAGG + Intronic
924867155 1:247996087-247996109 CAGCTGAAGGAGGAAGAGGAAGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063132833 10:3193427-3193449 CTGGGGCAGGAGGCAGAGGAAGG - Intergenic
1063222651 10:3984972-3984994 CTGGGAAGAGGGGAAGAGGAGGG + Intergenic
1063731177 10:8698893-8698915 CTGGGGAATGTAGGAGAGTAGGG - Intergenic
1063945425 10:11171513-11171535 CTGGGGAATGAACAGGAAGAAGG + Intronic
1064262718 10:13798939-13798961 CTGGGGAAGAAGGAAGGGAAAGG - Intronic
1064273117 10:13882663-13882685 CTGGGCAGTGAGGATGAAGAGGG - Intronic
1065098703 10:22311116-22311138 GGGGGGAAAGAGGAAGAGGAAGG - Intergenic
1065387142 10:25144792-25144814 ATGGAGAATGAAGAAGAAGAAGG + Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066109244 10:32181755-32181777 TTAGGGAAAGGGGAAGAGGAAGG - Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066244852 10:33572356-33572378 ATGGGGAGTGAGGAAGATAAAGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1066744970 10:38599879-38599901 CTGGAGGATGAGGAAAAGGCAGG - Intergenic
1066780489 10:38941411-38941433 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1066956236 10:42176689-42176711 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1067258305 10:44664440-44664462 ATGGAGAGTGAGGAATAGGATGG + Intergenic
1067299118 10:44993340-44993362 CTGGGGACTTTGGAAGAGGCAGG - Exonic
1067574928 10:47403118-47403140 AGGAGGAATGAGGGAGAGGAGGG + Intergenic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1067844767 10:49710867-49710889 CTGGGGAATGGGGAGAAGGAGGG - Intergenic
1068228658 10:54140578-54140600 CTGAGGACTGAGGCTGAGGAAGG - Intronic
1068326908 10:55502322-55502344 CTGGGCAAAGAGGATGAGAAGGG - Intronic
1068786095 10:60975923-60975945 GTGGAAAATGAGGAAGTGGAAGG + Intronic
1068861531 10:61852924-61852946 ATGGGGAATGAAGAAGAGGTAGG - Intergenic
1068965908 10:62911912-62911934 TTGGGGAATGATGAAGATCAGGG + Intronic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070001158 10:72378473-72378495 CTGGTGAAAGGCGAAGAGGAAGG - Intronic
1070171695 10:73937855-73937877 CTGGGGAAGGAGGAGGATGTTGG + Intergenic
1070228892 10:74542605-74542627 ATGGGGAATGAGGAAGATGAGGG - Intronic
1070442682 10:76462454-76462476 CTGGGTGAAGAGGAAGAGGATGG - Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1070729214 10:78813768-78813790 CAGGGGAGAGAGGAAGGGGAAGG - Intergenic
1070819689 10:79347657-79347679 CCGGAGGAGGAGGAAGAGGACGG - Exonic
1070837293 10:79457478-79457500 CTGTGGAAGGAGGGAGAGGCAGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071026265 10:81117632-81117654 CGGGGAAAGGAGGAAGGGGAGGG + Intergenic
1071402118 10:85283640-85283662 AGAGGGAATGAGGAAGTGGAAGG + Intergenic
1071404935 10:85320502-85320524 GTGGGGGATGAGGAAGATGTGGG - Intergenic
1071517878 10:86311015-86311037 CATGGGCAGGAGGAAGAGGAGGG + Intronic
1071718159 10:88117537-88117559 CTGGGGGAGGAGGAAGAGCACGG + Intergenic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1072102482 10:92242212-92242234 CAGGGGAATGAGGAATAGAAGGG - Intronic
1072308316 10:94129893-94129915 CTGGGGAATGAGAAAGGCCAGGG - Intronic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073758963 10:106610219-106610241 CCTTGGAATAAGGAAGAGGATGG + Intronic
1074287884 10:112115597-112115619 CTGGGAAGAGAGGGAGAGGAAGG + Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074675030 10:115838575-115838597 TCTGGGACTGAGGAAGAGGAGGG + Intronic
1074891469 10:117739579-117739601 ATGGGGCATGAGGACGACGAAGG + Intergenic
1074900626 10:117813406-117813428 CTGGGAAGTGGGGAAGAGAATGG + Intergenic
1075153177 10:119953518-119953540 GGGGGGAGGGAGGAAGAGGAAGG - Intergenic
1075153197 10:119953581-119953603 GGGGGGAGGGAGGAAGAGGAAGG - Intergenic
1075153217 10:119953644-119953666 GGGGGGAGGGAGGAAGAGGAAGG - Intergenic
1075153234 10:119953703-119953725 GGGGGCAAGGAGGAAGAGGAAGG - Intergenic
1075585428 10:123653775-123653797 AGGGGGAATGGGGAAGGGGAAGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076173220 10:128340643-128340665 CTCTGGAAGGAGGAACAGGAGGG - Intergenic
1076202476 10:128569483-128569505 CTGGGGAAGGAGGAGGAGAGAGG + Intergenic
1076208588 10:128623070-128623092 CTGGGGAGAGAGGAAGGGGCTGG + Intergenic
1076318886 10:129564230-129564252 AGGGGGAAGGGGGAAGAGGAGGG - Intronic
1076442344 10:130488606-130488628 AAGGGGATTGAGGAAGAGGCAGG + Intergenic
1076668950 10:132108612-132108634 CAGGTGAATGAGGCAGGGGAGGG - Intronic
1076714362 10:132355826-132355848 CCAGAGGATGAGGAAGAGGAAGG + Exonic
1077541236 11:3147439-3147461 CTGGGGCACGAGGGAGAGGCTGG - Intronic
1077607595 11:3622615-3622637 CAGGGGAAGGAGGGAGAGTAGGG - Intergenic
1078348047 11:10568871-10568893 CTGGGGGAGGAGGAACAGCAGGG - Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078430639 11:11285508-11285530 CTGTGGGATGAGGGAGAGGAGGG + Intronic
1078708034 11:13764213-13764235 CTGGGGAGTGGGGCAGAGGATGG - Intergenic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079062926 11:17265322-17265344 TTGGGTAATGAAGAAGAAGATGG + Intronic
1079131066 11:17747299-17747321 CTGGGGATGGAGGAAGAGCAGGG - Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1080783794 11:35455932-35455954 CTGGGGAATAAGTAAGTGGAAGG - Intronic
1081376362 11:42363297-42363319 CTGGAGAATGGGGTAGAGAAGGG + Intergenic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1081565134 11:44256051-44256073 CTGGGGAATTAGAAACAGCAAGG + Intergenic
1081611623 11:44566379-44566401 CTGGTGAGTGGGGAAGAGAAGGG + Intronic
1081650136 11:44818340-44818362 CTGGGGACAGAGGAAGGTGAGGG - Intronic
1082198705 11:49335914-49335936 GAGGGGAAGGAGGCAGAGGAGGG + Intergenic
1083096108 11:60253392-60253414 CTGGGGAAGGAGGCAGGGGGAGG - Intergenic
1083106366 11:60361914-60361936 CTGGGGAAGGAGGGAGGGGGAGG + Intronic
1083201340 11:61122884-61122906 CTGGGGAAGGAGGAAGAGTTAGG - Intronic
1083245620 11:61425602-61425624 GTGGGATATGAGGAAGAAGAGGG - Intronic
1083593267 11:63907457-63907479 CTGGGGATTGCAGAGGAGGAAGG - Intronic
1083887277 11:65579055-65579077 CTGGGGGAGGGGGAAGGGGAGGG - Intronic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084150153 11:67284358-67284380 CTGGGCCATGAGGAAGGTGAGGG + Exonic
1084212888 11:67631967-67631989 CTTGGGAAGGAGGAGCAGGAAGG - Intronic
1084561906 11:69910160-69910182 GTGGGGAGTGGGCAAGAGGAGGG - Intergenic
1084669118 11:70595045-70595067 TTGGGGAATGAGGAAGAATGAGG - Intronic
1084742715 11:71149938-71149960 GAGGGGAAGGAGGGAGAGGAGGG + Intronic
1085049218 11:73371372-73371394 ATGGGGAAAGAGGAAAAGGCAGG + Intergenic
1085338716 11:75717654-75717676 CTAAGGAAGGAGGAAGAGAAGGG - Intergenic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1085811327 11:79684612-79684634 CTTGGAAATGATGAAGGGGAAGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1087867642 11:103251683-103251705 CAGGGGAATGAAGGAGGGGATGG - Intronic
1088763918 11:112958632-112958654 CATGGGATTGAGGCAGAGGAAGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089182163 11:116590543-116590565 CTAGGGGGTGAGGAGGAGGAGGG - Intergenic
1089288002 11:117420017-117420039 CTGGGGAAGGAGGCTGAGGTGGG + Intergenic
1089474911 11:118751822-118751844 CTGGGGAAAGGGGACAAGGAAGG - Exonic
1089478889 11:118790148-118790170 ATGGGGGCTGAGGAAGAGAAAGG + Intronic
1089652824 11:119925799-119925821 CAGGGGAGTGAGGCAGAGAAAGG + Intergenic
1089700464 11:120241067-120241089 CTGTGGAAGGAGGAACAGCAAGG - Intronic
1089701401 11:120246219-120246241 CCGGGGAAAGGGGAAGAGAAAGG + Intronic
1089981007 11:122772499-122772521 AGAGGGAAGGAGGAAGAGGAGGG + Intronic
1090331116 11:125932751-125932773 CTGGGGAAGGATGGAAAGGAGGG + Intergenic
1090792769 11:130106248-130106270 ATGAGGGATGAGGAAGAGGAAGG - Intronic
1091027819 11:132157878-132157900 CTCAGGATTGAGGAAGAGGACGG - Intronic
1091086113 11:132723654-132723676 GTGGGCAATGAGAAAGAGAAAGG - Intronic
1091444530 12:535925-535947 CTGGGGGATAAGGAGGAAGAGGG + Intronic
1091744499 12:2982513-2982535 TTGGGGAAGGAGGAGGAGGCTGG + Intronic
1091940886 12:4480601-4480623 TTGGGGGATGAGGCAGAGCATGG - Intergenic
1092329597 12:7571515-7571537 CTGGGGAAGGAAGAAGAACATGG - Intergenic
1092490634 12:8941779-8941801 TGGGGGACTGAGGAAGAGGCTGG + Exonic
1092662140 12:10750018-10750040 CTGTAAAATGAGGAAGAGAATGG + Intergenic
1093179878 12:15954654-15954676 CTGGGGCTTGAGAATGAGGAAGG + Intronic
1093224009 12:16459362-16459384 GTGGTGAATGAGGAAGAAAATGG + Intronic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093517965 12:20013368-20013390 ATGGGGACTGAGGTTGAGGAGGG - Intergenic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1093823459 12:23651669-23651691 CTGGGGAAAGAATCAGAGGAGGG + Intronic
1093970990 12:25375923-25375945 TTAGGAAATCAGGAAGAGGATGG - Intergenic
1094118797 12:26946830-26946852 CTGAGGGATTAGGAAAAGGAAGG - Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095304544 12:40624277-40624299 GTGGGGAATAAGGGAGAAGAAGG + Intergenic
1095475063 12:42578514-42578536 CTTGGGAGTGTGGAAAAGGAAGG + Intronic
1095823663 12:46508638-46508660 ATAAAGAATGAGGAAGAGGATGG + Intergenic
1096312530 12:50534058-50534080 ATGGGGAATGAGTTAGAGTAAGG - Intronic
1096490001 12:52007934-52007956 CTGGGGCCAGAGGAAGAGGCTGG - Intronic
1096618449 12:52847759-52847781 CTGGGGAATGGGGACGCGGAGGG + Intronic
1096648974 12:53052774-53052796 GAGGAGAATGAGGAGGAGGAAGG + Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096695661 12:53346500-53346522 CTGGGAACTGGGGTAGAGGAAGG + Intergenic
1096816870 12:54207386-54207408 TTGGGCCATGAGGAAGAGGCTGG + Intergenic
1096878268 12:54647092-54647114 CTGGGGCAGGAGGAAGAGAAAGG + Intronic
1097045377 12:56183931-56183953 CTGGGGATAGAGGAAGAGAAGGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098101875 12:67026608-67026630 CAGGATAATGAAGAAGAGGAAGG - Intergenic
1098152153 12:67557830-67557852 CTGAGGAATGGGAAATAGGAAGG - Intergenic
1098425277 12:70357654-70357676 CTGGGGAAGGCAGAAGGGGATGG + Intergenic
1098482554 12:70982866-70982888 CTGGGGATTGAGGATGAGAGTGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099385309 12:82006249-82006271 GGGGGGAAGGAGGAAGGGGAGGG + Intergenic
1099935428 12:89119343-89119365 CGGGGGAAGGAGGGAGAGGGAGG - Intergenic
1100027885 12:90151901-90151923 CTGGGGATTAAGGAAGAGAGAGG + Intergenic
1100177645 12:92049425-92049447 CTGTGTAATGAACAAGAGGATGG + Intronic
1100461013 12:94799241-94799263 CTGAGGAATGAGGGAGATGTTGG + Intergenic
1100731673 12:97477720-97477742 CTCTGCAATGAGGAAGAGAAAGG + Intergenic
1100858048 12:98775755-98775777 CTGGGGAATAGAGAACAGGAGGG - Intronic
1101076056 12:101130850-101130872 TTGGGCAATGGGGAAGGGGAAGG - Intergenic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1101741983 12:107507767-107507789 CTAGGGGGTGGGGAAGAGGAGGG - Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102243349 12:111339361-111339383 CAGGGGGCTGAGGCAGAGGAGGG - Intronic
1102430992 12:112882677-112882699 CTGGGGAGTGAGGAGGAGCAGGG - Intronic
1102781908 12:115572830-115572852 CTGCGGCACGGGGAAGAGGAGGG - Intergenic
1102820159 12:115901793-115901815 CTGGGGATTTTGGAGGAGGACGG + Intergenic
1102934465 12:116884828-116884850 CTGGGGACTTGGGAAGAGGGAGG + Intergenic
1103125108 12:118415219-118415241 CTTGGGAACAAGGGAGAGGAAGG - Exonic
1103156073 12:118686023-118686045 AGGGGGAAGGAGGAAGAGAATGG - Intergenic
1103160334 12:118723865-118723887 GAGGAGGATGAGGAAGAGGAGGG - Intergenic
1103388470 12:120552636-120552658 CTGGGGAAAGAGGAACAAGTGGG + Exonic
1103601475 12:122057306-122057328 CTGGTGGGTGAGGAAGAGAATGG + Intronic
1103927616 12:124432637-124432659 CTGGGGAATGAGGAACTGCTTGG - Intronic
1103946939 12:124532090-124532112 CTGGAGAATGGGGATAAGGACGG + Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104180973 12:126380418-126380440 ATGGGGAATGAAGAAGACAAAGG + Intergenic
1104368843 12:128204276-128204298 CTGGGGGAAGAGGAAGAGGCAGG + Intergenic
1104536254 12:129620819-129620841 TTGGGGGATGAGGAAGAGGAAGG + Intronic
1104629848 12:130391174-130391196 CATGGGCCTGAGGAAGAGGAAGG + Intergenic
1104769415 12:131351650-131351672 CAGGAGGAAGAGGAAGAGGAGGG - Intergenic
1104801543 12:131558249-131558271 CTGGGGACAGAGGAACAGAAAGG + Intergenic
1104916420 12:132267182-132267204 CTGGGGAATGAGGGCAGGGAAGG + Intronic
1105296215 13:19089828-19089850 GTGGGAAATGAGAGAGAGGAGGG + Intergenic
1105486259 13:20835840-20835862 CAGGAGGAGGAGGAAGAGGAGGG - Intronic
1105636378 13:22219736-22219758 CTGGGAAATGAGGTGCAGGATGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105788714 13:23775513-23775535 CTGGGCATTGAGGATGAGTATGG - Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106243038 13:27925301-27925323 CAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106243051 13:27925350-27925372 CAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106250946 13:27981084-27981106 GTGAGGAATCAGGTAGAGGATGG + Intronic
1106263860 13:28092320-28092342 ATGGGAAATGAGGGAGAGGGAGG - Intronic
1106369648 13:29118859-29118881 CTGGGAAGTGAGGGAGTGGACGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106637509 13:31544716-31544738 ATGTGGAATGATGCAGAGGAGGG + Intergenic
1106756156 13:32824915-32824937 CTGGGCCCTGAAGAAGAGGACGG - Intergenic
1106788039 13:33126607-33126629 CTGGGGTTGGAGGAAAAGGAAGG + Intronic
1107021961 13:35761095-35761117 GTGTGGAATGATGAAGTGGAAGG + Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1108500053 13:51061440-51061462 TGGGGGTAGGAGGAAGAGGAGGG + Intergenic
1108609427 13:52069690-52069712 GTGGGAACTGAGGAAGAGAAGGG - Intronic
1109261033 13:60145192-60145214 CTGGGGACTGAGGGAAAGGAAGG - Intronic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110689615 13:78416944-78416966 CTATGGAGTGTGGAAGAGGAAGG + Intergenic
1111330871 13:86761131-86761153 TGGGGGAATGAGGAGGAGGCGGG + Intergenic
1111382444 13:87476218-87476240 CTGGTATATGAGGAAGAGGGAGG + Intergenic
1111599351 13:90451824-90451846 CTCGGGGACGAGGAAGAAGAGGG - Intergenic
1111743505 13:92234780-92234802 CTGGTGCAGGTGGAAGAGGAGGG + Intronic
1111898180 13:94167751-94167773 ATGAGGGAAGAGGAAGAGGAAGG + Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112167373 13:96933938-96933960 CTCGGGAAGGACGGAGAGGATGG + Intergenic
1112311071 13:98317982-98318004 GAGGAGGATGAGGAAGAGGAAGG - Intronic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113532823 13:111041806-111041828 CTGAGAAGTGAGGAAGAGGAGGG - Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114445335 14:22783916-22783938 CTAGGCTTTGAGGAAGAGGAGGG - Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115493339 14:33980108-33980130 CTGGGGGAAGAGGAAGTGGTTGG - Intronic
1115882977 14:37941194-37941216 GTGGGTAATGATTAAGAGGACGG - Intronic
1116638188 14:47424970-47424992 GTGGGGGATGATGAAAAGGAAGG + Intronic
1116885228 14:50214203-50214225 TTGGGGAATGGGGAAGTGGAAGG + Intronic
1116984903 14:51208029-51208051 GTTGGGATAGAGGAAGAGGAGGG - Intergenic
1117581048 14:57152086-57152108 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117978144 14:61318585-61318607 GAAGGGAATGAGGAAGAGGACGG - Intronic
1118282768 14:64444336-64444358 GTGGGGAAAGAGGAAGCGGTCGG - Intronic
1118346280 14:64943498-64943520 CTGGGGGATGAGGTGGAGGTGGG - Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1118979099 14:70701695-70701717 AGGGGAAAGGAGGAAGAGGAGGG + Intergenic
1119167789 14:72509734-72509756 CTGAGGATTGAGGAAGGGGTGGG + Intronic
1119168518 14:72515260-72515282 CTGGAGGAAGAGGAAGGGGAGGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119670899 14:76517595-76517617 CTGGGGATTGAGGAGGAGTGAGG - Intergenic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119766931 14:77196144-77196166 CTGGGGACTGATCAAGAGGAGGG + Intronic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1120527581 14:85595044-85595066 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121328176 14:93033937-93033959 CTGGGGACTGAGGATGGGGCAGG + Intronic
1121727933 14:96166512-96166534 GTGGGGAAGGAGGAAGAGAAGGG + Intergenic
1121812683 14:96905274-96905296 CTGGGGATTGAGGAAGTGAAAGG - Intronic
1121861700 14:97324774-97324796 ATGGGGGTTGAGGAAGGGGAAGG - Intergenic
1122091136 14:99341322-99341344 CTGGGGAAGGACGAGGAAGAAGG + Intergenic
1122133086 14:99617514-99617536 CTGGGGAGTGGGGAAAGGGAGGG + Intergenic
1122201850 14:100127629-100127651 GTGAGGAAGGAGGAAAAGGATGG - Intronic
1122270194 14:100565529-100565551 CTGGGGGGTGTGGGAGAGGAGGG + Intronic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1123111053 14:105866983-105867005 TGGGGGAGTGAGGAAGAGGGTGG + Intergenic
1202936755 14_KI270725v1_random:94693-94715 CTGGGGGATGAGGATAAGGCAGG + Intergenic
1123396443 15:19943066-19943088 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1123480116 15:20623253-20623275 CTTGGGCATGAGGAAGGGCAGGG + Intergenic
1123637891 15:22377111-22377133 CTTGGGCATGAGGAAGGGCAGGG - Intergenic
1123778404 15:23602690-23602712 CTGAGGAATGGGGAAGACGCAGG - Intronic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1123815202 15:23971206-23971228 CTGGGTAATGGGGAAGGTGATGG - Intergenic
1124162171 15:27282382-27282404 CTGGGGAAATAAGAAGAGCAGGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1125801964 15:42457159-42457181 CTAGGGAAAGAGGGAGATGAGGG + Exonic
1125925564 15:43560172-43560194 CTGGGGAATGAGTAACATTAGGG + Intronic
1125938708 15:43659723-43659745 CTGGGGAATGAGTAACATTAGGG + Intronic
1126337088 15:47597723-47597745 ATGGGGAATGAGGGAGATGTTGG + Intronic
1126370677 15:47943359-47943381 ATGGGGAATGGGGAAAGGGAGGG + Intergenic
1126385944 15:48093486-48093508 ATGGGCACTGAGGAAGATGAGGG - Intergenic
1126650085 15:50911294-50911316 TTGGGGAATGAGGAAAAGACAGG + Intronic
1127310453 15:57747464-57747486 GTGGGGCCTGAGGAGGAGGAGGG - Intronic
1127455093 15:59149730-59149752 CTGAGGGATGAGAGAGAGGAAGG + Intronic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128105406 15:65040651-65040673 AAGAGGAATGAGGAAGTGGAGGG + Intergenic
1128304173 15:66587076-66587098 GGGGAGAAGGAGGAAGAGGAAGG - Intronic
1128725548 15:69985841-69985863 CTGGAGGCTGGGGAAGAGGATGG + Intergenic
1128987295 15:72230826-72230848 TTGGGGCAGGAGGAAGAGGATGG + Intronic
1129163117 15:73758666-73758688 GTGGGAAGTGAGGAAGTGGAAGG - Intergenic
1129928210 15:79385014-79385036 ATGGAGAATGAAGAAGAGCAAGG + Intronic
1130072826 15:80663330-80663352 CTTAGGAATGAGGAAGTGGGAGG - Intergenic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1130474115 15:84248170-84248192 CTGGGAAAAGCAGAAGAGGAAGG + Intergenic
1130481530 15:84362238-84362260 CTGGGAAAAGCAGAAGAGGAAGG + Intergenic
1130551919 15:84894917-84894939 CTGGGGGATGAGACAGAGGAGGG - Intronic
1130606426 15:85321445-85321467 CTGGGGAGTGAGGGAGAACAGGG - Intergenic
1130765552 15:86867079-86867101 GTGAGTAATGAGGAAGAAGAGGG + Intronic
1130995128 15:88899288-88899310 CTGGGGACTGGGGAAGGGGAGGG - Exonic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131602156 15:93860515-93860537 CTGAGGAGTGAGGAAGACGGGGG + Intergenic
1131869330 15:96745387-96745409 ATGGTGAATGATGAAGAGGAAGG - Intergenic
1132026280 15:98406870-98406892 CTGGGGTAGGAGGAGAAGGAAGG - Intergenic
1132291368 15:100705995-100706017 AGGGTGAATGAGGAAGGGGAGGG + Intergenic
1132481790 16:169951-169973 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132482658 16:174208-174230 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132868227 16:2104220-2104242 GAGGGGGATGAGGAAGATGAGGG + Intronic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133299968 16:4776439-4776461 CAGGGGAATGAGGAAGGTGGGGG + Intergenic
1134016985 16:10895594-10895616 GTGGGGAACGAGGGAGAGGCGGG - Intronic
1134156024 16:11844064-11844086 CTGCGGAATGAGGAATGAGACGG + Intronic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134449268 16:14353882-14353904 CAGGGGGAGGAAGAAGAGGAGGG + Intergenic
1134692065 16:16197613-16197635 AGGGGGAAGGAGGAAAAGGAAGG + Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135465404 16:22680553-22680575 GTGGGGAGGGAGGCAGAGGATGG - Intergenic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1135928695 16:26718030-26718052 CTGGGGAATGATGAACACAAAGG - Intergenic
1136197955 16:28667010-28667032 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136259022 16:29061032-29061054 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136549751 16:30976641-30976663 GTGGGGAATGTTGGAGAGGATGG + Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136698919 16:32115216-32115238 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1136737904 16:32479112-32479134 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1136768689 16:32812607-32812629 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1136901905 16:34049739-34049761 CTGGGGGATGACGAAAAGGCAGG - Intergenic
1136957098 16:34801466-34801488 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1137844568 16:51674602-51674624 TTGGGGGCTGAGGACGAGGAGGG - Intergenic
1137854763 16:51783371-51783393 GTGGGGAATTGGGAATAGGAAGG - Intergenic
1137977964 16:53046889-53046911 CTGGGAGTTGAGGAAGAGGTTGG - Intergenic
1138103499 16:54273794-54273816 AATGGGAAAGAGGAAGAGGAAGG - Intergenic
1138217239 16:55214833-55214855 GGGAGGAATGAGGAAGAGGAAGG + Intergenic
1138659084 16:58507322-58507344 CTGCAAAATGAGGAAGAGGTCGG + Intronic
1139148304 16:64349166-64349188 ATGAGGAATGGGGAAGAGAATGG + Intergenic
1139189951 16:64850862-64850884 AGGGGGAAATAGGAAGAGGATGG + Intergenic
1139236314 16:65343300-65343322 CTGGGGACAGGGGAACAGGATGG + Intergenic
1139421456 16:66851759-66851781 ATGGGGAGAGAGGAAGAGGCTGG + Intronic
1139750709 16:69107389-69107411 CTGGGGTACCAGGAAGAGCAGGG + Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139946308 16:70644822-70644844 AGGAGGAAGGAGGAAGAGGAAGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1140194396 16:72844867-72844889 CTCGGAAATGAGGAAGGGGAGGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1140606982 16:76550914-76550936 TTGGGTAATGAAGAAGAGCAAGG + Intronic
1141149303 16:81553029-81553051 CTGGGGATTGAGGAGGAGTTAGG + Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141335029 16:83146504-83146526 CTGGGGCAGGAGTAACAGGAAGG + Intronic
1141337984 16:83175442-83175464 GTGGAGACTGGGGAAGAGGAAGG + Intronic
1141355172 16:83338803-83338825 CTGGATAATAAGGAAGAAGAGGG + Intronic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141659761 16:85435547-85435569 CTGGGGGCTGAGGGAGGGGAGGG + Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142112288 16:88339271-88339293 CAGGGGAATGGGGGACAGGATGG + Intergenic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142338688 16:89507125-89507147 CTCGGGGCTGAGGAAGAGGGAGG + Intronic
1142368548 16:89664416-89664438 GGGTGGAATGAGGAAGAGGGAGG + Intronic
1203015169 16_KI270728v1_random:350465-350487 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1203033504 16_KI270728v1_random:623623-623645 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1203071107 16_KI270728v1_random:1074715-1074737 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142849128 17:2695855-2695877 CTGCGGGAGGAGGAGGAGGATGG + Intronic
1143010167 17:3861871-3861893 CTGGGGCAGGAGGCAGAGGCAGG - Intronic
1143346024 17:6249959-6249981 CTGGGGAGGGAGGCAGAGGGAGG - Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391516 17:6561609-6561631 AGAGGGAAGGAGGAAGAGGAGGG - Intergenic
1143391583 17:6561840-6561862 GTGGAGGAAGAGGAAGAGGATGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143755089 17:9061191-9061213 CTGGTGGAGGAGGAAGGGGAGGG + Intronic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1143836330 17:9695778-9695800 CCAGAGACTGAGGAAGAGGAAGG - Intronic
1144051165 17:11498268-11498290 TTGGGGATGGAGGAGGAGGAAGG - Intronic
1144176887 17:12716231-12716253 ATGGGTAGAGAGGAAGAGGAGGG + Intronic
1144591533 17:16528319-16528341 ATGGGTAATGAGAAAGGGGAGGG + Intergenic
1144610376 17:16706893-16706915 CTGGGGAAAGATGAGGATGAGGG + Intronic
1144657015 17:17043086-17043108 CTGGGGCATGGGGACGGGGACGG + Intronic
1144902366 17:18608522-18608544 CTGGGGAAAGATGAGGATGAGGG - Intergenic
1144928696 17:18837456-18837478 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145130132 17:20337581-20337603 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145693068 17:26765460-26765482 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1145709809 17:26962087-26962109 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1145933521 17:28702050-28702072 TTGGGGCAGGAGGGAGAGGAGGG + Exonic
1146002269 17:29138488-29138510 CTAGGGATTGAGGGCGAGGAAGG + Intronic
1146034130 17:29390926-29390948 GTGAGGAGTGAGGAGGAGGAGGG - Exonic
1146274028 17:31503475-31503497 AAGGGGGAAGAGGAAGAGGAGGG + Intronic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1147288672 17:39423795-39423817 CTGGTGATTGAGGAGAAGGAAGG + Exonic
1147440672 17:40445470-40445492 CAGAGGATTGAGGAAGTGGAGGG - Intronic
1147492531 17:40883484-40883506 CTGGGGACTGAGGAATATTATGG - Intronic
1147727185 17:42573310-42573332 GTGGAGGAAGAGGAAGAGGATGG - Exonic
1147999054 17:44377042-44377064 GTGGGGAATCTGGAAGAGGCTGG - Exonic
1148573060 17:48685968-48685990 GTGGAGGAGGAGGAAGAGGATGG + Intergenic
1148853790 17:50567621-50567643 CTGGGGAATGGGGATGGGGGAGG - Intronic
1148861203 17:50605113-50605135 CTGGGAAGTGAGGAAGGGGAAGG - Intronic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149431414 17:56597442-56597464 GTGGGGAGTGGGGAAGAGGAGGG + Intergenic
1149502693 17:57166505-57166527 CTGGGGAAAGAGGAGGAGTGGGG + Intergenic
1149695541 17:58613349-58613371 CTGGGGCAAGAGGGTGAGGAGGG + Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150156997 17:62862002-62862024 TGGGGGGATGTGGAAGAGGAGGG + Intergenic
1150355392 17:64479793-64479815 GTAGAGAATGAGGAAGAGGGAGG + Intronic
1151069272 17:71189717-71189739 CCGGGGAAGGAGGAAGAGAGAGG + Intergenic
1151113680 17:71708049-71708071 CTTAGGGATGAGGAAGGGGATGG - Intergenic
1151174948 17:72280028-72280050 CTGAGGCATGAGCAAGATGAAGG - Intergenic
1151224738 17:72640061-72640083 CTGGGGTGTGTGGAAGATGAAGG + Intergenic
1151707209 17:75775531-75775553 CTGCAGAATAAGGAAAAGGAAGG - Intergenic
1151820849 17:76496016-76496038 CTGAGGAATGAGGAGGAATAAGG + Intronic
1152069321 17:78127180-78127202 CTGGGAAATGGGGAAGAGGTAGG + Intronic
1152074239 17:78148931-78148953 CTGGGCAATGCGGGAGAGGCAGG + Intronic
1152203659 17:78961812-78961834 CTGGGGAATGAGGAAGAGTGGGG + Intergenic
1152279450 17:79376672-79376694 CGGGGGCTGGAGGAAGAGGAGGG + Intronic
1152310995 17:79549661-79549683 CTGGGGAAGGAGACAAAGGAAGG + Intergenic
1152336753 17:79703189-79703211 CTGGGGTACGAGGAGGAGGTGGG - Intergenic
1152377948 17:79928338-79928360 ATGGGGAATGAGGTAGGGGATGG + Intergenic
1152400838 17:80065238-80065260 CTTGGGAATGAGGAGGAGGAGGG - Intronic
1152577992 17:81151322-81151344 CTGGGGGATGTGGGGGAGGAGGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152707737 17:81853755-81853777 CTGGGGAGTGAGGGGCAGGAGGG - Intronic
1152829199 17:82486701-82486723 CTGGGGCCTGAGGAAGGAGAAGG + Intronic
1153145508 18:2027321-2027343 CTGGGGGATGAAGGAGAGAAAGG - Intergenic
1153291879 18:3509712-3509734 GTGGGGAATGAGGTTGAGAAAGG - Intronic
1153899982 18:9609691-9609713 CTGGAGAATGATAGAGAGGATGG - Intronic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154031558 18:10757601-10757623 ATGGGGGATGAGGAAGAGGGAGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154518474 18:15198669-15198691 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1155092857 18:22528145-22528167 GTGGAGACAGAGGAAGAGGATGG - Intergenic
1155293634 18:24365654-24365676 CTGGGGCATGGGAAAGGGGAAGG + Intronic
1155497161 18:26454064-26454086 GTCTGGAATGAGGAAGAGGAGGG + Intergenic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1156254079 18:35378247-35378269 CTGAGGAATTAGGGAGAGGACGG + Intergenic
1156361185 18:36386251-36386273 CAGGGAGATGAGGCAGAGGACGG - Intronic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157168042 18:45376397-45376419 CAGGGGAATGAGGGAAATGATGG + Intronic
1157193490 18:45600635-45600657 GGGGGCAATGAGGAAGAGGCTGG + Intronic
1157487767 18:48100766-48100788 CTGGGGAATGGGGGAGGGGGAGG + Intronic
1157867297 18:51197512-51197534 CAGGGGAAGGAGGCAGAGGTAGG + Intronic
1158327947 18:56330342-56330364 GTGGGGCATGGGGAAGATGAAGG + Intergenic
1158449967 18:57555470-57555492 GTGGGGAGAGAGGAAGTGGAAGG - Intronic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1158915330 18:62120202-62120224 CTGGGGGAAGGGGAAGGGGAAGG + Intronic
1159912756 18:74161989-74162011 ATGGGGAATGTGCAAAAGGAAGG + Intergenic
1159913144 18:74165237-74165259 CTGGGGAAGGAAGGAGTGGATGG - Intergenic
1160173994 18:76578676-76578698 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160174579 18:76582225-76582247 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160505092 18:79422572-79422594 CAGGGGAGTGAGGGAGAGGGAGG + Intronic
1160943348 19:1630174-1630196 CGGGGGTATGAGGAAGAGGCTGG + Intronic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161503760 19:4632871-4632893 CGGGAGGCTGAGGAAGAGGAAGG + Intergenic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161658899 19:5533893-5533915 GTGGGGGAAGAGGAAGAAGAAGG - Intergenic
1161864293 19:6822258-6822280 GTGGAGAATGAGGAGGCGGAAGG + Exonic
1162043018 19:7981802-7981824 CTGGGTGGTGAGGATGAGGAAGG + Intronic
1162054175 19:8052956-8052978 GTAAGGACTGAGGAAGAGGAGGG - Intronic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162391023 19:10390300-10390322 GTGGGGAATGAGGAGGAGGCTGG + Intergenic
1162581079 19:11530749-11530771 CTGGGGAGTGGGTAAGATGATGG + Intergenic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1162968430 19:14166532-14166554 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1163031147 19:14545091-14545113 CTGGGGACAGAGGAACAGTAAGG - Intronic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163160012 19:15458688-15458710 ATGGGGGATGGGGAAGAGGCAGG - Intronic
1163464509 19:17459335-17459357 ATGGAGAATGAGGAAAGGGAAGG - Intronic
1163634723 19:18432703-18432725 CCGGGGGATGAGGAGGAGTAGGG - Exonic
1163667259 19:18609117-18609139 GGGCGGAATGAGGGAGAGGAGGG - Intronic
1163875311 19:19862862-19862884 CTGGGGAAAGAAGGAGAGCATGG - Intergenic
1164347329 19:27282546-27282568 CAGGGGAATTAGGCAGAAGAAGG - Intergenic
1164896845 19:31884143-31884165 GTGAGTAATGAGGAAGAGGGAGG - Intergenic
1164908333 19:31985554-31985576 TGGGGGAAAGAGGAAGAGAAGGG + Intergenic
1165085943 19:33347643-33347665 CTGGGGAGTTCGGAAGAGGGAGG + Intergenic
1165255880 19:34577032-34577054 CTGGGGAAGGAGGGATAGGATGG + Intergenic
1165455691 19:35909359-35909381 CTGCTGAATGAGGAAGTGGCTGG + Intergenic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166089299 19:40497857-40497879 ATTGAGAATGGGGAAGAGGAGGG - Intronic
1166597303 19:44061175-44061197 ATGGAGAATGAGGGAGAGTATGG - Intronic
1166666797 19:44684940-44684962 GTGGGGAAGGAGGAAAAGGTGGG + Intergenic
1167115934 19:47489080-47489102 CTGGGGCAGGAGGAACAGGATGG + Intronic
1167177308 19:47873987-47874009 CTGAGAAATGAGGACAAGGACGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167270476 19:48503035-48503057 TTGGGGCAGGATGAAGAGGAAGG - Intronic
1167526200 19:49985403-49985425 CTGCGGAAAGAGGAAGAGACAGG - Intronic
1167627722 19:50603801-50603823 CAGGGGACTGAGGCAGGGGATGG - Intergenic
1167628081 19:50605695-50605717 CAGGGGACTGAGGCAGGGGATGG - Intergenic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167791760 19:51687938-51687960 CTGGGGAGAGAGGAAGGGGTGGG - Intergenic
1167959812 19:53096760-53096782 CGGGTGATTGAGGGAGAGGACGG - Intronic
1167963611 19:53126601-53126623 CGGGTGATTGAGGGAGAGGAGGG - Intronic
1167969925 19:53182913-53182935 CTGGAAGAAGAGGAAGAGGAAGG - Exonic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168503580 19:56914186-56914208 GCGGAGAAGGAGGAAGAGGAGGG + Intergenic
1202683063 1_KI270712v1_random:28380-28402 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
924989096 2:295866-295888 CTGGGGCATGGAGATGAGGATGG + Intergenic
925128089 2:1476090-1476112 CTGGGCACTGAGGAGTAGGAAGG - Intronic
925178885 2:1803853-1803875 CGAGGGTATGTGGAAGAGGAGGG + Intronic
925347317 2:3179992-3180014 CCGGGGAAGGAGGAAGAGACAGG - Intergenic
925413080 2:3651196-3651218 GTGGGAAAAGAGGACGAGGACGG + Intergenic
925462257 2:4073673-4073695 CCGGGAAATGGGGAACAGGATGG + Intergenic
925626466 2:5846455-5846477 CTGGGAAATGAGACAGAGAAGGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
925897353 2:8482925-8482947 CTTGGTTCTGAGGAAGAGGAGGG - Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
925991781 2:9260284-9260306 CTGGGTCATGAGGATGAGGTGGG + Intronic
926166144 2:10523005-10523027 GTGGGGACTGAGGAATAAGAAGG + Intergenic
926208272 2:10849404-10849426 CTGGAGCAGGAGGAAGAGGGTGG + Intronic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926442686 2:12906934-12906956 GTGGGGAATGGGGAAGTGGTGGG - Intergenic
926874468 2:17459258-17459280 CGGTGGGAAGAGGAAGAGGAAGG + Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927638221 2:24831345-24831367 CTGGGTAGAGAGGAAGTGGAGGG - Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928409367 2:31042656-31042678 GTGGAGAGTAAGGAAGAGGAAGG - Intronic
928427016 2:31187717-31187739 GTGGGGGGTGAGGAAGAGCAGGG - Intronic
928455484 2:31416827-31416849 CTGGGGAATGCCTAGGAGGAAGG - Intergenic
928800779 2:35088694-35088716 CTGAGTAATGGGGAAGAGAAGGG + Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929288516 2:40163468-40163490 AGGGTGAATGAGGAAGAGGGAGG + Intronic
929431740 2:41893198-41893220 CCGGGGAGGGAGGAAGGGGAAGG - Intergenic
929680887 2:43992588-43992610 CTAGGGAATGATGAAGGGGCTGG + Intronic
930084053 2:47480196-47480218 GAAGGGAAGGAGGAAGAGGAGGG - Intronic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930790948 2:55328027-55328049 GGGTGGAATGAGGAAGAGGCAGG - Intronic
931168693 2:59779011-59779033 CTGGGGATTGGGGGAGTGGAGGG + Intergenic
931321838 2:61179818-61179840 CCAGGGACTGGGGAAGAGGAGGG - Intronic
931332300 2:61300301-61300323 AAGGAGAATGGGGAAGAGGATGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931685244 2:64786869-64786891 TGGGGGAATGAGGGTGAGGATGG + Intergenic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932236509 2:70125001-70125023 GTGGAAAATGAGGAAGAGGGCGG + Intergenic
932631092 2:73344122-73344144 CTGGGGAGTGAGGATGAGGTGGG + Intergenic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932757447 2:74418153-74418175 CTGGAGAAGGAGGAAGAGAAGGG - Intronic
932759250 2:74428738-74428760 CTGGGGGAGGAGGAAGTGCAGGG + Intronic
932777730 2:74538367-74538389 CTGGGGAATGAGGGCTATGAGGG + Intronic
932816632 2:74867019-74867041 TGGGGGTATGAGGAACAGGATGG + Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
933129013 2:78649737-78649759 TTGGGAGAGGAGGAAGAGGAGGG - Intergenic
933316014 2:80716274-80716296 CTGGGGAATAAAGCACAGGAAGG - Intergenic
933810943 2:86032351-86032373 GAGGGTGATGAGGAAGAGGAGGG - Exonic
933901393 2:86852915-86852937 CTGGGGAAGGAAGGAGGGGAGGG + Intronic
934189098 2:89768455-89768477 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
934248735 2:90326793-90326815 CTGGGGCATGAGGAAAAGGCAGG + Intergenic
934260845 2:91476690-91476712 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
934304170 2:91808640-91808662 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
934329085 2:92044110-92044132 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
934467304 2:94274033-94274055 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
934808909 2:97265206-97265228 CTGGGGCCTGGGGGAGAGGATGG + Intergenic
934828596 2:97491963-97491985 CTGGGGCCTGGGGGAGAGGATGG - Intergenic
934925958 2:98381877-98381899 GTGGGGAAAGAGGAAGAGGGAGG + Intronic
935016908 2:99191492-99191514 CTGGGAAATTAGATAGAGGATGG - Intronic
935727135 2:106033398-106033420 CAGGGGATTGGGGAAGAAGAGGG + Intergenic
935779157 2:106496322-106496344 CTGGGGAAGGAAGGAGGGGAGGG - Intergenic
936020050 2:108988041-108988063 CTGGGGACTGGGGAAGAGGACGG + Intronic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936070729 2:109369569-109369591 CTGGGGGTTGGGGGAGAGGATGG + Intronic
936378856 2:111966783-111966805 CTTGGGAATGGGGAAGAATAAGG - Intronic
936418596 2:112343183-112343205 CTGAGGAATGAGGTGGAGGATGG + Intergenic
936855119 2:116948358-116948380 GAGGGGAAGGAGGGAGAGGAGGG + Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
936946338 2:117934333-117934355 CTGGGGTATGAGTAGGTGGAGGG - Intronic
937208722 2:120253312-120253334 CGGAGGACTGAGGAAGTGGACGG - Intronic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
937917324 2:127105655-127105677 CTGGGGGATGGGGGAGAGGGGGG - Intronic
938078941 2:128359009-128359031 CTGGGGAATGGGGAGGAATATGG + Intergenic
938370906 2:130767880-130767902 CTGGAGCTTGAGGAAGAGCAGGG - Exonic
938391374 2:130909072-130909094 GTGGGGAGTGAGGAAGGGAATGG + Intronic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
939669123 2:144987714-144987736 GTGGGGAATTGGGAAGAGTAGGG + Intergenic
939755634 2:146105769-146105791 TTGGGGAATAAGGTAGAGGAAGG - Intergenic
939957438 2:148538805-148538827 CTGGGTGTTGAGGAAAAGGAGGG - Intergenic
939976347 2:148720778-148720800 ACGGGGAATGAGGAAAAGCAGGG - Intronic
940638745 2:156327552-156327574 CTGGTGTATATGGAAGAGGAGGG + Intronic
940724977 2:157326725-157326747 CTTGGGCTTGAGGAAGAGAAGGG - Intronic
940738848 2:157483988-157484010 TTGGGCAAAGAGGCAGAGGAAGG + Intronic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
940984872 2:160043057-160043079 GGGGTGAATGAAGAAGAGGAAGG + Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941905378 2:170713928-170713950 GCGGGGAAGGAGGAAGAGGCGGG - Exonic
942042278 2:172078815-172078837 CTGGGGAAGGATGCAAAGGAGGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942321755 2:174742149-174742171 CTGGGGAAGGAGGCAGAGGGAGG - Intergenic
942438370 2:176005126-176005148 ATGGGGACTGAGGGAGAGGGAGG + Intergenic
942489267 2:176473750-176473772 CGGGGGTCAGAGGAAGAGGAGGG - Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943247880 2:185478387-185478409 CTGGTGGATGAGGGAGATGAGGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944069168 2:195650855-195650877 GTGGGGTCTGTGGAAGAGGATGG + Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
944628561 2:201598204-201598226 CTGGAGGCTGAGGCAGAGGATGG - Intronic
944775954 2:202964739-202964761 CTAGGGAATGAGGAAGTGTAAGG - Intronic
945416320 2:209577346-209577368 CTGGGGAGAGAGGATGATGATGG + Intronic
945701761 2:213179256-213179278 TTGGGGAAAGGGCAAGAGGAAGG + Intergenic
945718554 2:213388380-213388402 GTGGGGAATGAGAAAAACGAAGG - Intronic
946039102 2:216768806-216768828 CTGGGCCATGAAGAAGAGGTAGG + Intergenic
946170360 2:217891738-217891760 GTGAGGGAAGAGGAAGAGGAGGG - Intronic
946237387 2:218332535-218332557 ATGGGGAAGGAGGAAGGGAAGGG - Intronic
946706031 2:222459778-222459800 ATGGTGAATCAGGAAGAGCATGG - Intronic
946708789 2:222485711-222485733 CTGGGGTGTGGGGAAGATGAAGG - Intronic
946878829 2:224157622-224157644 CAGGGGAGTGAGGAAGAAGGTGG + Intergenic
947050582 2:226038497-226038519 CTGGGGATTGAAGAGGAAGAAGG + Intergenic
947117114 2:226783391-226783413 ATGTGGCATGAGGAAGAGGAAGG - Intronic
947222006 2:227802836-227802858 CTAAGGAATGGAGAAGAGGATGG - Intergenic
947232693 2:227903688-227903710 CTGGGGTGGGAGGAAGGGGAGGG - Intronic
947426709 2:229990085-229990107 CTAGGAAATGAGGAACAGAAAGG - Intronic
947982953 2:234425720-234425742 CAGGTGAAAGAGGAAGAGGCAGG - Intergenic
948155579 2:235778482-235778504 CTGGGGCAGGAGGAAGAGCACGG - Intronic
948157528 2:235795446-235795468 CGGGAGCATGAGGAATAGGAAGG - Intronic
948341523 2:237256525-237256547 CTGAGGAATGAGGCACAGGAGGG + Intergenic
948424280 2:237877653-237877675 CTGGGGAATGACTGAGAGTAGGG + Intronic
948449413 2:238060236-238060258 TTGGGGCATGAGGGACAGGAAGG - Intronic
948483311 2:238263979-238264001 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
948858817 2:240743119-240743141 CTTGGGTGGGAGGAAGAGGAGGG + Intronic
948931781 2:241136807-241136829 CTGGGGAAGGGTGGAGAGGAAGG + Intronic
949025447 2:241765478-241765500 CTGAGGGATTAGGAAGAGGGGGG + Intronic
949047315 2:241877891-241877913 AGGGGGAAAGAGGAAGGGGAGGG - Intergenic
1168934852 20:1656301-1656323 ATGGGGAGTGAGGCAGAGGCAGG - Intronic
1169194056 20:3673980-3674002 GTGGGGTTTGGGGAAGAGGAAGG - Intronic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1169457354 20:5763602-5763624 TAGGGGAAAGAGGAAGAGTATGG - Intronic
1169525287 20:6417658-6417680 CAGGACAATGAGGAAGGGGAAGG + Intergenic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169621702 20:7514204-7514226 CCGAGGAATGAAGAAGAGGATGG - Intergenic
1169630542 20:7626025-7626047 CTGGGCACTGAGGCAGAGGGGGG - Intergenic
1169672729 20:8121306-8121328 CAGGAGAAAGAGGGAGAGGATGG + Intergenic
1169709654 20:8547524-8547546 ATGGGCAATGAGGAAGAGGGAGG - Intronic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1170032685 20:11959282-11959304 CTGGTGAGAGAGGGAGAGGAGGG + Intergenic
1170059513 20:12244684-12244706 GTGGAGAATGAGGAGGAGAAAGG - Intergenic
1170455188 20:16526167-16526189 CTGGGGACTCAGGAAGAGAACGG - Exonic
1170533025 20:17313581-17313603 TTGGGGAATGAGGTTGATGAGGG - Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1172049853 20:32109184-32109206 GATGGGAATGAGGAAGAGCAAGG + Intergenic
1172208182 20:33179574-33179596 CGGAGAAAGGAGGAAGAGGAGGG - Intronic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172483443 20:35285008-35285030 GTGAGGCATGAGGGAGAGGAGGG + Intergenic
1172520393 20:35562071-35562093 CTGGGGGATGAGGATGAAGGTGG + Intergenic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172627563 20:36356879-36356901 GTGGGGAATGAGGTAGAGGGAGG - Intronic
1172658044 20:36548920-36548942 CTGAGGAATGAGGACGTGGCAGG - Intronic
1172697470 20:36832447-36832469 CTGGGGAATCATGGAGAGGATGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173009508 20:39169024-39169046 CTGGGGAATGAAGCCCAGGATGG - Intergenic
1173095639 20:40025451-40025473 AGAAGGAATGAGGAAGAGGAAGG + Intergenic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173210368 20:41027798-41027820 GTGGGAAATGAGGGAAAGGAAGG + Intergenic
1173527062 20:43741128-43741150 ATGGGGAAGGAGGAAAAGAAAGG - Intergenic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1174295165 20:49540460-49540482 CCGGGGTGTGAGGCAGAGGATGG + Intronic
1174358896 20:50015671-50015693 CTGGGGAGTGGCGAAGAGGTGGG + Intergenic
1174509589 20:51041026-51041048 TGGGGGAAGGAGGAAGTGGAGGG - Intergenic
1175241167 20:57550446-57550468 CTGGGGAATGAGGTGGGGTACGG + Intergenic
1175284340 20:57827837-57827859 CTGGGGGATGGGGAAGGGGATGG + Intergenic
1175452103 20:59077955-59077977 GAGGGGGAGGAGGAAGAGGAAGG + Intergenic
1175553373 20:59831279-59831301 CTGGGGAGCCAGGAAGAGGCTGG - Intronic
1175746791 20:61462670-61462692 CTAGGGAAGGAGGGAGAGGGGGG - Intronic
1176097761 20:63352152-63352174 TCAGGGAATGAGGCAGAGGAGGG - Intronic
1176408267 21:6433649-6433671 GTCGGGAATGAAGAAGGGGATGG + Intergenic
1176416653 21:6479296-6479318 GTGCGGAAAGAGGAGGAGGAGGG - Intergenic
1176586558 21:8594283-8594305 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1176743256 21:10626993-10627015 CTGGGGGATGAGGCAAAGGCAGG - Intergenic
1177220939 21:18192007-18192029 CTTGGGTTTGAGAAAGAGGAAGG + Intronic
1177470301 21:21552658-21552680 CTGGAGAAGGAGGAAGAGAGTGG - Intergenic
1177745229 21:25204596-25204618 CTGGGGAAAGAGTAAGAGTGAGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177791724 21:25729938-25729960 ATGGGGAATAAGGAGGAGAAGGG - Intronic
1178790281 21:35693381-35693403 GTGTGGAATGAGCACGAGGAAGG - Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1178931109 21:36820119-36820141 ATCGGGAATGAGGCAAAGGAAGG + Intronic
1179492308 21:41748752-41748774 CTGGGGCTTGAGCAGGAGGAAGG + Intronic
1179638508 21:42731363-42731385 CTGGGGCATGAGCTAGAGGATGG + Intronic
1179683761 21:43041975-43041997 GTCGGGAATGAGGAAGGGGATGG + Intergenic
1180269366 22:10571188-10571210 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1180281207 22:10698466-10698488 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
1180534492 22:16386336-16386358 CTGGTGGATGAGGAAAAGGCAGG - Intergenic
1180651477 22:17380964-17380986 ATGGGGAATGGAGAAGAGAAAGG - Intronic
1181114886 22:20625812-20625834 AGGGGGTATGAGGAGGAGGAGGG - Intergenic
1181130158 22:20726515-20726537 CTGGGGGATGTAGAAGAGGATGG + Exonic
1181338800 22:22162261-22162283 CTGGGGCATGAGGATGCTGAGGG - Intergenic
1181348765 22:22240415-22240437 CAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1181462736 22:23095006-23095028 CAGGTGCATGAGGGAGAGGAGGG - Intronic
1181552993 22:23651675-23651697 CAGGGAGTTGAGGAAGAGGAGGG + Intergenic
1181780222 22:25187032-25187054 CCTAGGAATGAGGAAGAAGAGGG - Intronic
1181824945 22:25507484-25507506 CTGTGGAATGAAGGAAAGGATGG - Intergenic
1182079021 22:27516071-27516093 GTGGAGGATGAGGGAGAGGAAGG - Intergenic
1182351676 22:29703285-29703307 CTGGCGAGTGAGGAGGGGGAAGG - Intergenic
1182456589 22:30455658-30455680 TTGGGGAAGGAGTAAGAGGCAGG + Intronic
1182657856 22:31904087-31904109 CTAGGGGCTGAGGAAGATGAAGG - Intronic
1182657864 22:31904129-31904151 CTAGGGGCTGAGGAAGATGAAGG - Intronic
1182657873 22:31904171-31904193 CTAGGGGCTGAGGAAGATGAAGG - Intronic
1182674906 22:32031544-32031566 CTGAGGAATTAGGAAGATGGTGG - Intergenic
1182847044 22:33439895-33439917 GTGAGGAATGAGGAGCAGGAGGG - Intronic
1183138485 22:35913848-35913870 AAGGGGAATGAGGAAGGGGTGGG + Intronic
1183191814 22:36326441-36326463 TTGGGGAATGAAGCAGAGGCTGG - Intronic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183323369 22:37178349-37178371 TTAGGCAATGAGGAAGGGGAAGG - Intergenic
1183350536 22:37332292-37332314 CTTAGAAATGAGGAAGTGGAGGG + Intergenic
1183622724 22:38983899-38983921 CTGAGGGGAGAGGAAGAGGAGGG - Intronic
1183629141 22:39022647-39022669 CTGAGGGGAGAGGAAGAGGAGGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1183928819 22:41224687-41224709 ATAGGGAATGAGGGAGAGAAGGG - Intronic
1184096790 22:42320462-42320484 GTGGGGATTGAGGTGGAGGAAGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
1184549275 22:45195936-45195958 GTGGGGGAAAAGGAAGAGGAGGG - Exonic
1184657387 22:45948596-45948618 CTGTGGCAAGAGGCAGAGGAGGG - Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1184838098 22:47035880-47035902 CAGGGGGAAGAGGAACAGGAGGG - Intronic
1184927198 22:47651257-47651279 CTGGGGAAGGAGGAGAAGGTGGG + Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184983870 22:48115750-48115772 CTGGAGGATGAGGAAGAAGGAGG - Intergenic
1185241179 22:49748633-49748655 CTGGGGAAACAGGAAGACAAGGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203238292 22_KI270732v1_random:29935-29957 CTGGGGCATGAGGAAAAGGCAGG - Intergenic
1203289361 22_KI270735v1_random:18450-18472 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
949180537 3:1124714-1124736 TTGGGGAGTGAAGAAGCGGAAGG - Intronic
949631019 3:5926628-5926650 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
949668873 3:6375208-6375230 CTGGGGAATGTCAAAGAGGGTGG - Intergenic
950212976 3:11137428-11137450 CTGGGGCGTGGGGAAGAGAATGG + Intronic
950772732 3:15325025-15325047 CTGAGCAATGAGGAAAAGGACGG + Intronic
950804858 3:15591428-15591450 GGAGGGAATGAGGAGGAGGAGGG - Intronic
951185352 3:19706206-19706228 CTAGTTAAGGAGGAAGAGGAAGG + Intergenic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951806775 3:26653201-26653223 GTGGGGAAAGAGGAAAATGAGGG + Intronic
951816005 3:26755655-26755677 TTGGGGAATTAGGATGAGGTGGG + Intergenic
951926368 3:27912954-27912976 GTGGAGAATGAAGAACAGGAAGG + Intergenic
952114362 3:30161392-30161414 GCGAGGAATGGGGAAGAGGAGGG - Intergenic
952384827 3:32832778-32832800 CTAGGAAGGGAGGAAGAGGAGGG - Intronic
952648793 3:35696956-35696978 CTCTGGGATGAAGAAGAGGAAGG - Intronic
952853612 3:37749628-37749650 CTGAGAAATGAGGAAAAAGATGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953019180 3:39103195-39103217 CTGGGGCATGAGGGATATGAGGG - Intronic
953321302 3:41974342-41974364 TTGGGGAATGAAGAAGGAGAAGG - Intergenic
953479157 3:43234528-43234550 CTGGGGAAAGAGGAGGAGTGAGG - Intergenic
953498729 3:43412354-43412376 TAGGAGAATGAGGAAAAGGAGGG + Intronic
953499990 3:43424037-43424059 TGGGGGAATGAGGATGATGAGGG - Intronic
953637893 3:44678001-44678023 CAGGGCAATGAGGTAGATGATGG + Intergenic
954091498 3:48287912-48287934 CTGGAGAGTGAGGAAGGGGGAGG + Intronic
954105697 3:48408807-48408829 GTGGGGGATGAGGAAGAAGGAGG - Intronic
954510637 3:51121702-51121724 GTGGGGAATGAGGGAGAGAAAGG + Intronic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
954613564 3:51958481-51958503 ATGGGAAAGGTGGAAGAGGAAGG + Intronic
954623073 3:52006654-52006676 CTGGGGTATGAAGATGGGGATGG - Intergenic
954862538 3:53702768-53702790 CCGGAGAATGAGGAAGAAGGAGG + Exonic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
954990890 3:54839823-54839845 CTGGGGAACGAGGGATTGGAGGG - Intronic
955107931 3:55917629-55917651 CTGGGGTTTGAGGAAGGGCAGGG + Intronic
955307457 3:57848584-57848606 AGGAGGAAGGAGGAAGAGGAGGG - Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955727065 3:61944419-61944441 AGGGGAAATGAGGAAGACGATGG - Intronic
956056952 3:65309841-65309863 CTGGACAGTGAGGAAGAGGGAGG - Intergenic
956084583 3:65596674-65596696 CTTAGGACTTAGGAAGAGGAAGG + Intronic
956258835 3:67314513-67314535 CTGAGATATGAGGAAGAGGCAGG - Intergenic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956741563 3:72279914-72279936 GTGGGGAAGGAAGAGGAGGAGGG + Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957261007 3:77901154-77901176 ATAGGGTATGAGGAAGAAGAGGG + Intergenic
957690264 3:83556955-83556977 ATGGAGAATGAGGAAAAGAAGGG - Intergenic
958013161 3:87906687-87906709 CGGGGGAATGAGTGAGAGGGGGG - Intergenic
958208187 3:90432644-90432666 CAGGGCAATGAGGCAGAAGAAGG - Intergenic
959014940 3:101123168-101123190 GTAGGGAAGGAGGAAGAAGAGGG + Intergenic
959065666 3:101654404-101654426 CTGGAAAATGAAGAAGAGGGGGG + Intronic
959348251 3:105227122-105227144 CTGGGCAATCTGGAAGAGGGAGG - Intergenic
960004974 3:112772514-112772536 GTCAGGAATGAGGAAGAGGATGG - Intronic
960010645 3:112830995-112831017 TTGGGGAAGGAGGAATAGGGGGG + Intronic
960068158 3:113397713-113397735 ATGGGGAATGAAGCAGAGGGAGG + Intronic
960157807 3:114315327-114315349 CTGGGAATTGAGGAAGAGTTTGG - Intergenic
960164010 3:114381290-114381312 TTGGGACATGAGGAAGAGAAGGG + Intronic
960394302 3:117117499-117117521 CAAGAGAATGAGGAAGAAGAAGG + Intronic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
960940870 3:122933073-122933095 TTGGGGGATGAGGAAGAGGATGG - Intronic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961075987 3:123982429-123982451 CTGGTGGAGGAGGGAGAGGATGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961350093 3:126294543-126294565 GTGGGGCAGGAGGAAGAGCAAGG + Intergenic
961366514 3:126402969-126402991 GTGTGGAATGAGGGAGAAGAGGG + Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961714195 3:128847568-128847590 CTGGGCAGGGAGGAAGGGGAAGG + Intergenic
961740761 3:129031964-129031986 CTGGGTGGAGAGGAAGAGGAGGG + Intronic
961862344 3:129927014-129927036 CGGGGGAGTGGGGAAAAGGAGGG - Intergenic
961998505 3:131271026-131271048 TTGGGGAGTGGGCAAGAGGAAGG - Intronic
962020975 3:131501859-131501881 GTGGGGAGTGAGGAAAAGGTTGG - Intronic
962156344 3:132952601-132952623 ATGAGAGATGAGGAAGAGGAAGG - Intergenic
962611593 3:137081748-137081770 CTGGGGAATGAGAATGTGGTGGG + Intergenic
964323651 3:155523961-155523983 CTTGGGGATGATGCAGAGGAAGG - Exonic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965904231 3:173683282-173683304 TGGGGGGAAGAGGAAGAGGAAGG - Intronic
965932342 3:174060344-174060366 ATAGGGAAAGAGGAAGAAGAAGG + Intronic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
966636337 3:182138152-182138174 CTGGGTATTGAGGTAGAGGAAGG + Intergenic
966807284 3:183817484-183817506 CTGGGTAGTGGGGAAGAGTAGGG - Intronic
967456477 3:189692433-189692455 GTGGGGAGGGAGGAAGGGGAAGG - Intronic
967501845 3:190206503-190206525 CTGAGGAAAGAGGAAGAACATGG - Intergenic
967517905 3:190392267-190392289 AGGGGGAATAAAGAAGAGGAAGG - Intronic
967557669 3:190877293-190877315 CAGGGGACTGAGGCAGGGGATGG + Intronic
967829973 3:193910178-193910200 CTGGGGAATGAAGAAGAGTTAGG - Intergenic
968087011 3:195878342-195878364 CTGGGCCTGGAGGAAGAGGAAGG + Exonic
968348007 3:198027507-198027529 CTGGGGGAGGAGGAAGAGGGAGG - Intronic
968516638 4:1018309-1018331 CTAGGGAAGGAGGAGGAGCAGGG - Intronic
968517260 4:1020621-1020643 GTGGGGACTGAGGCAGGGGATGG + Intronic
968613087 4:1565889-1565911 CTGGGGACTGCGGTAGAGGCAGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968654492 4:1772683-1772705 CTGGGGGATGAGGGAGGGGCCGG + Intergenic
968956956 4:3724302-3724324 TGGGGGGATGAGGAAGAGGGAGG + Intergenic
968963694 4:3758683-3758705 GAGGGGGAAGAGGAAGAGGAGGG + Intergenic
969230794 4:5828907-5828929 CTGGGGCATCACAAAGAGGAAGG + Intronic
969549261 4:7853504-7853526 ATGAGGACTGGGGAAGAGGAGGG - Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969581899 4:8070766-8070788 CTGGGGAAGGAAAGAGAGGAGGG + Intronic
970859939 4:20690743-20690765 CTGCAGAATAAGGAAGAGCATGG - Intergenic
971149874 4:24020725-24020747 CTCCGGAATGAGGATGAGGAAGG - Intergenic
971767730 4:30854781-30854803 CTTGGAAAAGTGGAAGAGGAGGG + Intronic
972647529 4:40983156-40983178 CAGGGAAATGAGGAACAGGGAGG + Intronic
973601778 4:52549434-52549456 CCAGGGAACCAGGAAGAGGATGG + Intergenic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
973829371 4:54742906-54742928 TTGGGGAAGGGTGAAGAGGAAGG + Intergenic
973885611 4:55318020-55318042 GAGGGCAAGGAGGAAGAGGAAGG + Intergenic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974017792 4:56664777-56664799 CTGGGGAATGGTGGTGAGGAAGG - Intronic
974090738 4:57308053-57308075 CTAGGGAATGAGGTATAGAAAGG + Intergenic
974118683 4:57611819-57611841 CAGGGGGATGAGGGATAGGAGGG + Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
975043827 4:69777538-69777560 ATGGAGAAAGAGGAAGACGATGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975689655 4:76950594-76950616 CTGGGACGCGAGGAAGAGGAAGG + Intronic
975756980 4:77580755-77580777 GAGGGGAAGGAGGGAGAGGAGGG - Intronic
975857922 4:78644140-78644162 GTATGGACTGAGGAAGAGGAAGG + Intergenic
976213730 4:82695788-82695810 CTAGGCAAAGAAGAAGAGGAGGG - Intronic
976402727 4:84625431-84625453 CAGGAGCATGAAGAAGAGGAAGG + Intronic
976645943 4:87387452-87387474 CTGGAGAATGAGGAAGAAAGTGG - Intronic
976916354 4:90379928-90379950 CAGGGGCAAGAGGAAGAGAAGGG + Intronic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977163944 4:93672161-93672183 CTGGGGAATGATCTAGAAGAGGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977435728 4:96991678-96991700 CTTGGGAATGTGCAGGAGGAGGG + Intergenic
977660905 4:99584853-99584875 TTGGGGAAGGAGGGAGTGGAAGG - Intronic
978227396 4:106353619-106353641 ATGGGAAAAGATGAAGAGGAAGG + Intergenic
978264754 4:106810353-106810375 GAGGGGGAGGAGGAAGAGGAGGG - Intergenic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
978782084 4:112566853-112566875 ATTGGGGATGGGGAAGAGGATGG - Intronic
979480143 4:121207166-121207188 CTGGAAATTGAAGAAGAGGAAGG + Intronic
980277498 4:130673667-130673689 CTAGGGAGGGAGGAAGTGGAGGG - Intergenic
980532841 4:134076520-134076542 GTGGGGAGTCAGGAAAAGGAAGG + Intergenic
981087398 4:140698303-140698325 ATGGGGATTGAGTGAGAGGAAGG - Intronic
981198085 4:141943576-141943598 CTGGGGAGTGAGGACTATGATGG - Intergenic
982043682 4:151420426-151420448 ATGGGGAAAAAGGAAGAGGTAGG - Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982498741 4:156127436-156127458 CTGGGGTATGGGGAGAAGGAGGG + Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983740153 4:171120771-171120793 CTGTGGAATTGGGAAGACGATGG - Intergenic
983912167 4:173252227-173252249 ATGAGGGATGAGGATGAGGAAGG - Intronic
984265333 4:177491801-177491823 CTGGGAGATGAGGAAAAGGATGG + Intergenic
984852844 4:184168899-184168921 TGGGGGAATGAGGAAGCGGGGGG - Intronic
984919225 4:184749271-184749293 CTGGAGGCTGAGGAAGGGGAGGG + Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985407195 4:189649689-189649711 ATGGGGAATGAAGAAAAGAAAGG + Intergenic
985485475 5:146148-146170 CTGCAGAATGGGGGAGAGGAGGG - Intronic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986103032 5:4631318-4631340 CCTGGGAATGAGGCAGAGAAAGG + Intergenic
986146020 5:5078752-5078774 CTGGGGAGTGAGGAAATGCAAGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987202267 5:15589406-15589428 CTGGAGAAGGAGGAAGAGAGAGG - Intronic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988443726 5:31261208-31261230 GTGGGCAATGAGGATGAAGATGG - Intronic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988690418 5:33566504-33566526 ATGGGGAATGAAGAAGAGAGAGG - Intronic
988977716 5:36531241-36531263 CTTGGGCATGAGGCTGAGGAGGG - Intergenic
989057579 5:37379754-37379776 CTGGAGAGAGAGGAAGAGAAAGG + Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
990048637 5:51467080-51467102 CTGGGGATTAAAGAAGAGGTGGG + Intergenic
990499908 5:56385752-56385774 ATGGGAGAGGAGGAAGAGGAGGG - Intergenic
990561760 5:56990582-56990604 CTGGGGAATGACGGAGATGGTGG - Intergenic
990562333 5:56995601-56995623 CTGAGGAATAAAGAAGAGAAAGG + Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
990771737 5:59254266-59254288 CTTGGGATTGAGAAATAGGAGGG - Intronic
991929521 5:71738806-71738828 CTGGGGCCTGAGGAAGCTGAAGG + Intergenic
992381850 5:76245284-76245306 TTGGAGGAAGAGGAAGAGGAAGG + Intronic
992956117 5:81910116-81910138 GAGGGGCAAGAGGAAGAGGAGGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993098516 5:83508097-83508119 AAGGGGAATGAGGCAGAGCAGGG - Intronic
993349826 5:86835923-86835945 CAGGGGAATGGGGTAGAGAAAGG + Intergenic
993840903 5:92877149-92877171 CTGGGAAAGGAGGAAGAGCATGG - Intergenic
994209289 5:97070280-97070302 CTGGAGAAAGAGGAAGGGTAAGG - Intergenic
994209604 5:97073312-97073334 CTGGGGAGTGGGGAAGCGAATGG - Intergenic
994920659 5:106039012-106039034 CATGGGGATGAGAAAGAGGAAGG - Intergenic
995460576 5:112399166-112399188 CTGGGGTATAAGGAGGAGAAAGG - Intronic
995504071 5:112840606-112840628 CTGGAGAAGGAGTTAGAGGAGGG + Exonic
995731058 5:115242718-115242740 CTTGGGGAGGAGGCAGAGGAGGG + Intronic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
995984075 5:118147031-118147053 CCGGGGAAAGAGGAAGGGAAAGG - Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996096429 5:119404067-119404089 GGGGGCAAGGAGGAAGAGGAGGG - Intergenic
996472291 5:123874950-123874972 CTGGTGACTGCTGAAGAGGAGGG + Intergenic
996482428 5:123989988-123990010 CTGGGAGAGGAAGAAGAGGAGGG + Intergenic
996587620 5:125108216-125108238 CTGAGGAATGATGAAGACAATGG + Intergenic
996911010 5:128656571-128656593 CTGGAGCAGGAGGAAGAGCAAGG + Intronic
996988232 5:129594786-129594808 TTGGGGAAGGGAGAAGAGGAGGG - Intronic
997295195 5:132764558-132764580 CTGGGGAATGGGGGTGATGAGGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997701690 5:135906390-135906412 CTGAGGAATGAGGAAGAGTGTGG - Intergenic
998040384 5:138947600-138947622 TTGGGGATAGAGGAAGAGGTGGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998384686 5:141749955-141749977 GTGGGGAATGGGGAATAGGGTGG + Intergenic
998394726 5:141811462-141811484 AAGGGGAATGAGGAAGGAGATGG - Intergenic
998592355 5:143490767-143490789 CAGAGGAATGGGGTAGAGGATGG - Intergenic
998629369 5:143881415-143881437 CTGGGGATTGAGGAATAAGTAGG - Intergenic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998917582 5:147032504-147032526 CGGGGGAAAGAGGGAGAGGGGGG - Intronic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999371234 5:151056572-151056594 GGGAGGGATGAGGAAGAGGAAGG - Intronic
999374549 5:151077736-151077758 CTGGGGATGGAGGTAGAGGGTGG - Intronic
999533796 5:152493874-152493896 CTGGGGCAGGAGGAAGAGAGAGG + Intergenic
1000153414 5:158526419-158526441 TTGGGGCATGAAGAAGAGGAAGG + Intergenic
1000193298 5:158934487-158934509 CTGGAGAAAGAGGAAGAAAAAGG - Intronic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1000232675 5:159330711-159330733 GTGGGGAATAAGGAAGGAGATGG + Exonic
1001317904 5:170657351-170657373 CTGGGAAATGAGGGTGAGGAGGG + Intronic
1001468482 5:171990142-171990164 AAGGGGAAAGAGGAAGAGAAGGG + Intronic
1001549586 5:172593431-172593453 GTGTGGGGTGAGGAAGAGGAAGG + Intergenic
1001759813 5:174198031-174198053 CTGTGCAATGAGGAAGAGAGTGG + Intronic
1002171604 5:177377844-177377866 CTTGGGGCTGGGGAAGAGGATGG + Intergenic
1002205248 5:177558325-177558347 CTGGGGAGAGAGGAAGAAGTAGG - Intergenic
1002257960 5:177973052-177973074 CTTGGGAACAAGGGAGAGGAAGG - Intergenic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002461468 5:179375938-179375960 CTGGGGGAGGGGGAAGAGGGAGG + Intergenic
1002555086 5:180030963-180030985 AGGGGGTAGGAGGAAGAGGACGG - Intronic
1002661673 5:180795166-180795188 CTGGGGATGGAGGCAGAGAAGGG + Intronic
1002994302 6:2268500-2268522 CTTGGGAGTGGGGAAGAAGAGGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003294435 6:4811893-4811915 CTGATGAATGGGGAAGAGGGTGG - Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003407961 6:5838928-5838950 CTGGAGAATGAGGATGGGGCGGG + Intergenic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003576097 6:7296723-7296745 TGAGGGAATGGGGAAGAGGAGGG + Intronic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004258337 6:14085363-14085385 GTGGGCGATGAGAAAGAGGAAGG - Intergenic
1004292126 6:14377176-14377198 CTGGGGCACGCTGAAGAGGAAGG - Intergenic
1004294844 6:14401211-14401233 CTAGGGAAAGAGAAAGAGTAGGG - Intergenic
1004329269 6:14706869-14706891 GTGGGGGATGAGAAAGAGAAAGG + Intergenic
1004442196 6:15664068-15664090 ATGGGGAATGAGGAAAAGAGGGG - Intergenic
1004542285 6:16562409-16562431 AAGGGGAATGGGGAAGGGGAAGG + Intronic
1005196306 6:23288152-23288174 CTGGGGAAAGAAGTAGAGAAGGG + Intergenic
1005728555 6:28673404-28673426 GTGGGGAAAGTGGAATAGGATGG - Intergenic
1005840531 6:29742250-29742272 CTGGGGAAAGAGGGAGAGAAAGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005969281 6:30748836-30748858 CTAGGGCATTAGGCAGAGGAGGG + Intergenic
1006176743 6:32127143-32127165 CTGAGGGAGGAGGAAGAGCAGGG + Exonic
1006340733 6:33445209-33445231 CTAGGGCCTGAGGAAGAGGGCGG + Intronic
1006403224 6:33829780-33829802 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403237 6:33829835-33829857 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403250 6:33829890-33829912 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403263 6:33829945-33829967 CAGGGATGTGAGGAAGAGGAGGG - Intergenic
1006403275 6:33830000-33830022 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006524888 6:34595869-34595891 CCAGGAAATGAGGAAGAGGAGGG - Intronic
1006705912 6:36021204-36021226 CTGGGGAATACAGAAGAGGATGG + Intronic
1007017467 6:38483128-38483150 CAGAGAAATGATGAAGAGGATGG - Intronic
1007184873 6:39961221-39961243 ATGGGAAATGAGAAACAGGAAGG - Intergenic
1007440262 6:41853361-41853383 CCAGGGACTGGGGAAGAGGATGG + Intronic
1007540335 6:42636771-42636793 ATGGGGAATGGGGGAAAGGAGGG + Intronic
1007599888 6:43075268-43075290 CTGGGGGATGGGGAAGAAGGAGG + Intergenic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1008134389 6:47757026-47757048 CTTGGAAATTAGGAAGAGTAAGG + Intergenic
1009022602 6:57960930-57960952 CTGGAGAGAGAGGAAGAGAAAGG - Intergenic
1009413938 6:63395729-63395751 CTGGGGAAGGATCAAGAGGCTGG + Intergenic
1010919792 6:81667210-81667232 CTGAGGAATGAGGATGGTGATGG + Intronic
1010952958 6:82058497-82058519 CTAGAGCATGAGGAAGAGGGAGG + Intergenic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1011798438 6:90982949-90982971 ATGGGGAAGGATGAAAAGGAGGG - Intergenic
1012422149 6:99077319-99077341 TGGGGGCATGAGGAAGAGCAGGG + Intergenic
1012631274 6:101470617-101470639 CTGGGGATGGGGGAAGAGTAGGG + Intronic
1012956476 6:105576325-105576347 CTGGGGAAGGAGGTCAAGGAAGG - Intergenic
1013269577 6:108533654-108533676 GTGGGGAATAAGGAAGAGAAGGG + Intergenic
1013619118 6:111872350-111872372 TGGGGGACAGAGGAAGAGGAGGG + Intronic
1013994536 6:116292960-116292982 CTGGGGGATGAGGATGGGAAGGG + Intronic
1014323144 6:119957296-119957318 GTGGGAAAAGAGGAACAGGAAGG + Intergenic
1014755994 6:125302181-125302203 CAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014885355 6:126773726-126773748 GTTGGGAATGAAGAAGAAGAGGG + Intergenic
1015186682 6:130425002-130425024 CTGGGGATGGAGTAAGAGGGAGG - Intronic
1015445265 6:133296569-133296591 GTGGGGTCTGAGGAAAAGGAAGG + Intronic
1015659500 6:135559326-135559348 CAGGGGAAGGGGGAATAGGAAGG + Intergenic
1016330303 6:142946732-142946754 CTGGGAAATGGGGAAGGGGTGGG - Intergenic
1016561143 6:145396284-145396306 AAAGGGAATGAGGGAGAGGAAGG - Intergenic
1016801723 6:148175499-148175521 GGGGGAAATGAGGAAAAGGAAGG + Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017051913 6:150401380-150401402 CTGAGTAATGAAGAAGAGGAAGG + Exonic
1017251526 6:152285201-152285223 CTGGTGAGTGAAGGAGAGGAAGG - Intronic
1017708468 6:157146183-157146205 CTGGGGACTGTGGCAGAAGAGGG - Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018674207 6:166205195-166205217 CCTGGTAGTGAGGAAGAGGATGG - Intergenic
1018729401 6:166637404-166637426 GCCAGGAATGAGGAAGAGGAGGG - Intronic
1018792336 6:167158007-167158029 TTGGGGAAAGAGGATGAGCAGGG + Exonic
1018824973 6:167402045-167402067 CTGGAGAAGGAGGAACCGGAGGG + Intergenic
1018861770 6:167715652-167715674 GTGGAGGAGGAGGAAGAGGAGGG + Intergenic
1019084783 6:169465856-169465878 CCAGGGACTGAGGAAGGGGATGG + Intronic
1019262145 7:87694-87716 CTGGGCACTGGGGAAAAGGAAGG - Intergenic
1019364298 7:623922-623944 CTAGGGAAGGAGGTGGAGGATGG + Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019611888 7:1940945-1940967 CTGCGGGGGGAGGAAGAGGAGGG - Intronic
1019730551 7:2627297-2627319 GGAGGGAGTGAGGAAGAGGAGGG + Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020048015 7:5057992-5058014 CTGGAGAAAGAGGAAGTGAATGG - Intronic
1020331765 7:7025384-7025406 CTAGGGGATGAGGCAGAGGGAGG - Intergenic
1020533129 7:9359722-9359744 CTGGGATATGAGGAAGAGAGGGG - Intergenic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1020858801 7:13462010-13462032 TTGGGGAATGAGGAAAAAGTAGG - Intergenic
1021161613 7:17280113-17280135 CTGGGGAATGAGAGAAGGGAAGG + Intergenic
1021804615 7:24342823-24342845 CTGAGGGATGAGGGAGAGGCAGG - Intergenic
1022044555 7:26612599-26612621 CTGAGGAGTGAGGCAGAGCAGGG - Intergenic
1022354585 7:29600832-29600854 CTGGGGACTTAGGAAGGGGCTGG + Intergenic
1022665930 7:32410442-32410464 GTGGAGGAGGAGGAAGAGGAAGG + Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022938271 7:35203422-35203444 TTGGCAGATGAGGAAGAGGAGGG - Intronic
1022995989 7:35756154-35756176 CTGGGGAATGAGGGTGAAGGTGG - Intergenic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1023909417 7:44542651-44542673 ATGGGGAATGAGCCAGGGGATGG + Intergenic
1024059129 7:45685372-45685394 CTGGGCCAGGAGGAACAGGATGG + Intronic
1024059186 7:45685633-45685655 CGGGGGCAGGAGGAACAGGATGG + Intronic
1024164332 7:46715239-46715261 CTTGAGGTTGAGGAAGAGGAGGG - Intronic
1024274695 7:47668183-47668205 CTGGGGACCGAGGAAGGGGCAGG + Intergenic
1024610036 7:51056229-51056251 TGGGGGCATGAGGAAGAGCAGGG + Intronic
1024706694 7:51969373-51969395 CAGGGATCTGAGGAAGAGGAAGG + Intergenic
1025307078 7:57869790-57869812 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1025481607 7:60991397-60991419 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1025561589 7:62378944-62378966 CTGGGGGATGAGGAAAAGGCAGG - Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1025838638 7:65122677-65122699 CTAGGGGATGAGGAAAAGGCAGG - Intergenic
1025878635 7:65510423-65510445 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1025884434 7:65573305-65573327 CTAGGGGATGAGGAAAAGGCAGG + Intergenic
1025942443 7:66083997-66084019 CAGGGAGTTGAGGAAGAGGAGGG - Intronic
1025944029 7:66092745-66092767 CTGGGGAGAGAGGAAGAGGTGGG - Intronic
1026132418 7:67631293-67631315 CGGGGGCAAGAGGAAGGGGAGGG + Intergenic
1026451124 7:70530615-70530637 CTGGGGGCTGGGGAAGAGGGAGG - Intronic
1026772391 7:73210838-73210860 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1026894914 7:74004344-74004366 CTGGGGAGTGAGGTGGAGGGAGG - Intergenic
1027013259 7:74764237-74764259 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1027074781 7:75181797-75181819 ATGGGGAAAGAGGAAGGGGACGG - Intergenic
1027235452 7:76295062-76295084 GTGGGCAATGAAGAAGGGGAAGG + Intergenic
1027414547 7:77961400-77961422 CTGGGGACTGAGGGAGAGTTGGG - Intergenic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028562929 7:92195299-92195321 ATGGGAAATAAGGAAGAGGTAGG - Intergenic
1029005822 7:97208020-97208042 AGGAGGAATGAGGAAGATGATGG - Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029420061 7:100467703-100467725 GTAGAGAATGAGGGAGAGGAGGG + Intronic
1029440321 7:100583680-100583702 CTGGGCAGAGAGGAAGAGAAAGG - Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1030047719 7:105512497-105512519 TTGTGGCATAAGGAAGAGGAAGG + Intronic
1030161236 7:106510424-106510446 CTGGAGGATGAGGACAAGGAGGG + Intergenic
1030333931 7:108303331-108303353 ATGAAGAATGAGGAAGAGCAAGG - Intronic
1030934605 7:115569831-115569853 CTGGGAATTTAGGAAGAGAAAGG - Intergenic
1030996213 7:116361491-116361513 ATGGTGAAAGATGAAGAGGAAGG - Intronic
1031101036 7:117479909-117479931 CGGGGGAAAGAGCAAAAGGAAGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032122816 7:129169163-129169185 ACGGGGAATGAGGAGGAAGAAGG + Intronic
1032619116 7:133509522-133509544 CCAGGGAGAGAGGAAGAGGAAGG - Intronic
1033033278 7:137846986-137847008 CTCGGGATTTAGGAAGAGGCCGG - Intronic
1033046044 7:137962880-137962902 CTGGGGGATGAGTGCGAGGATGG - Intronic
1033197701 7:139341555-139341577 CTGGGGAGGGAGGAAGAGCCGGG + Intronic
1033229921 7:139588669-139588691 CTGGAGGCTGAGGACGAGGAGGG + Intronic
1033234246 7:139625622-139625644 GTGAAGGATGAGGAAGAGGATGG - Intronic
1033415627 7:141158957-141158979 AAGGGAAATGAGGAAGAGGTTGG + Intronic
1033499164 7:141930292-141930314 CTCTGGAATCAGGAAGAGGCTGG - Intronic
1034089423 7:148350208-148350230 GTGGGGAATGTGGAAGAGAGAGG + Intronic
1034183113 7:149153986-149154008 CTGGGGGTGTAGGAAGAGGAAGG - Exonic
1034257193 7:149731133-149731155 CTGGAGGACGAGGACGAGGAGGG + Intronic
1034263836 7:149772347-149772369 CTGGGGACTGGGGACGGGGAGGG - Intronic
1035018306 7:155785541-155785563 CTGGGGGCTCAGGAAGGGGATGG - Intergenic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035077719 7:156191956-156191978 CTGAGGAAAGAGGAATAGCAAGG - Intergenic
1035224681 7:157426709-157426731 CTGGGGAAGGAGGGAGAGCGAGG + Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035479067 7:159167560-159167582 CAGGGGAAGGAGGGAGAGGGTGG - Intergenic
1035547799 8:497138-497160 CTGGGTAATGGGGCAGAGGCTGG + Intronic
1035620087 8:1029909-1029931 GTGGGCAATGTGGAAAAGGAGGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036185945 8:6622409-6622431 CTGGGGAATGCGGAGGAAGCAGG + Intronic
1036295217 8:7529242-7529264 CTGGAGAAGGAGGAGGAGAAGGG - Intergenic
1036327353 8:7791776-7791798 CTGGAGAAGGAGGAGGAGAAGGG + Intergenic
1036387348 8:8294051-8294073 CCTGGGAAAGAAGAAGAGGAGGG + Intergenic
1036466602 8:9003288-9003310 CTGGGCACCGAGGAAGAGGCTGG - Intronic
1036654947 8:10671900-10671922 CTGGGCAGTGAGGCAGAGGAAGG + Intronic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1036812672 8:11878355-11878377 GTAGGCAATGAGGATGAGGAGGG + Intergenic
1037128103 8:15374233-15374255 CTGGGAAATGCTGAAGAAGAAGG - Intergenic
1037255483 8:16947980-16948002 CAGGGCAATTAGGCAGAGGAAGG + Intergenic
1037316996 8:17608497-17608519 CTGGGGAAGGAGGCAGAGGGAGG + Intronic
1037755403 8:21706914-21706936 CCAGGGCAGGAGGAAGAGGAAGG - Intronic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038461106 8:27717850-27717872 CTAAGGCATTAGGAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038520833 8:28230705-28230727 GGGGGAAATGTGGAAGAGGAGGG - Intergenic
1039253857 8:35696792-35696814 CTGGAGAATGGGGAAGGGCAGGG - Intronic
1039481270 8:37875097-37875119 TTGGGGGATGGGGAGGAGGACGG + Exonic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039611721 8:38924428-38924450 CTGGGGAAGGAGGACAGGGAAGG + Intronic
1039920180 8:41888220-41888242 CTTGGGAAAGAGGAGGGGGACGG - Intronic
1040022552 8:42753943-42753965 CTGGGGAATGAGTTTGAGGCAGG + Intronic
1040387157 8:46921322-46921344 CAGGGGAAGGAGGAACAGGCTGG + Intergenic
1040609825 8:48973073-48973095 ATGGGGAATGAGGGGGAGGGAGG - Intergenic
1041087278 8:54268549-54268571 CTGGGCAAAGTGGAAGAGGCTGG + Intergenic
1041758533 8:61339260-61339282 CTGGGGAATGGGGGATGGGACGG - Intronic
1041873487 8:62661608-62661630 GTGGGGAAGGAGGAAGAGAGAGG - Intronic
1041910892 8:63087015-63087037 CTGGGGAATGAAGATGAAGTAGG + Intergenic
1042054286 8:64747561-64747583 GAGGAGGATGAGGAAGAGGAGGG + Intronic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042089779 8:65146041-65146063 CTGGGGACTGTGAAAGAGAATGG + Intergenic
1042244127 8:66693978-66694000 CTGGGCAAAGTGGAAGAGGGAGG - Intronic
1042491274 8:69401255-69401277 CTGGGGAATGAGGGAGGTGGGGG + Intergenic
1042566011 8:70112772-70112794 ATGGGGAATGAGAGAGGGGAAGG + Exonic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043003740 8:74792171-74792193 CTGGGGAAGGAGGGAGAGTACGG + Intronic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043313560 8:78892727-78892749 CTGGGGAATGGTGCAGAAGAAGG - Intergenic
1043358342 8:79440278-79440300 CTGGGGAAGTAGGAAGGGGGTGG + Intergenic
1043499205 8:80836438-80836460 ATGGGGAATGAGGAGGGAGAGGG - Intronic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043875826 8:85484842-85484864 CTGGGTGATGAGGAAAAGCAAGG - Intergenic
1044407828 8:91850177-91850199 TTGGGGTATGAGGGAGAGGTGGG + Intergenic
1044942169 8:97354386-97354408 CCAGAAAATGAGGAAGAGGAGGG - Intergenic
1045054087 8:98354373-98354395 CTGGTGAAGGAAGGAGAGGAGGG - Intergenic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1045501183 8:102745554-102745576 CTGGGGAGTGAGGGGGCGGAGGG - Intergenic
1045648164 8:104319377-104319399 ATGAGGAAGGAGGAAGAGGTTGG + Intergenic
1045842645 8:106597754-106597776 CTGGGGAATGGGGAATCCGAGGG - Intronic
1046003176 8:108445569-108445591 GTGGGGGATGAGGAAAGGGAAGG - Intronic
1046095345 8:109552441-109552463 CCAGAGAATGAGGAAGAGAATGG + Intronic
1046583240 8:116119615-116119637 CTTGGGGAAGAGGCAGAGGATGG - Intergenic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1046739734 8:117815324-117815346 ATGGAGAATGAGGAAGATGTAGG + Intronic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047303391 8:123634163-123634185 CCCTGGAGTGAGGAAGAGGAGGG + Intergenic
1047577178 8:126169416-126169438 ATGAGGAGTGAGGAGGAGGAAGG - Intergenic
1047818763 8:128495160-128495182 ATGAGGATTGAGGAAGAGGATGG - Intergenic
1048010749 8:130453744-130453766 CAGGGGAATGAGGAAGGGAAAGG + Intergenic
1048543537 8:135365036-135365058 CTTGAGAATTGGGAAGAGGACGG - Intergenic
1048671380 8:136726551-136726573 GAGGGGAATGAGGAAGAGTCTGG - Intergenic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049315824 8:141966818-141966840 GTGGGGATGGAGGAAGGGGATGG + Intergenic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1049879366 8:145051919-145051941 CTGGGAAATGGGGAAGAGCGAGG - Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050671631 9:8004364-8004386 CAGGGCAATGAGGCAGGGGAAGG - Intergenic
1051366355 9:16324150-16324172 CTGAGGAAAAAGGAAGGGGAGGG + Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053017007 9:34667616-34667638 CTGGGAAAGGAAGGAGAGGAAGG + Intergenic
1053199408 9:36142538-36142560 CTGAGGAATGAGGAAGACGCAGG - Intronic
1053697724 9:40652129-40652151 TTGGGGGATGAGGAAAAGGCAGG + Intergenic
1053943751 9:43280987-43281009 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1054309015 9:63451537-63451559 TTGGGGGATGAGGAAAAGGCAGG + Intergenic
1054407810 9:64775655-64775677 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1054440956 9:65259485-65259507 TTGGGGGATGAGGAAAAGGCAGG + Intergenic
1054489321 9:65762001-65762023 TTGGGGGATGAGGAAAAGGCAGG - Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054754453 9:68943234-68943256 CAGATGAATGAGGAAGAGGGTGG - Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055238801 9:74158541-74158563 CTGAGGAGTGAGGACGTGGAGGG + Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055380129 9:75697607-75697629 CTGGGGAATGTGGGAGAAGAAGG + Intergenic
1056069109 9:82967542-82967564 CTGGGGAGAGCGGAAGAGCAAGG - Intergenic
1056081902 9:83103742-83103764 CAGGGGTCTAAGGAAGAGGATGG - Intergenic
1056154043 9:83817542-83817564 CGGGGGGAGGAGGGAGAGGAGGG - Exonic
1056261987 9:84858150-84858172 CTGGGTATTGGGGAAGGGGAAGG - Intronic
1056356454 9:85805551-85805573 CGGGGGGAGGAGGGAGAGGAGGG + Intergenic
1056389292 9:86125958-86125980 CTAGGGAATGAGGAATGGGTGGG + Intergenic
1056425161 9:86468308-86468330 TGGAGGAATGAGGAAAAGGAAGG + Intergenic
1056656005 9:88509673-88509695 CTGGGGATTGAGGAACTGGGTGG - Intergenic
1056681511 9:88723081-88723103 GTGGGGAATGAGCAAGGGCAGGG - Intergenic
1056834734 9:89945231-89945253 AAGGTGAATGGGGAAGAGGAAGG - Intergenic
1057003461 9:91534191-91534213 CTGGGGAAGAAGGCAGAGTAGGG + Intergenic
1057168859 9:92948936-92948958 CTGAGGTTTGAGGATGAGGAGGG - Intronic
1057213911 9:93217973-93217995 CTGGGCAATGAGGAAGGGCTGGG - Intronic
1057302581 9:93895397-93895419 CTGTGGATTGGGGTAGAGGATGG - Intergenic
1057713972 9:97474056-97474078 ATGGGTAAGGAGGAAGATGAAGG - Intronic
1057774134 9:97991983-97992005 CTGCGGAATGAGGAAAAAAACGG - Intronic
1057775198 9:98002174-98002196 GTGGTTAATGAGGATGAGGATGG - Intronic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1058647433 9:107143581-107143603 CCAGGGTATAAGGAAGAGGAAGG - Intergenic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059458800 9:114416534-114416556 CTGGAGGAGGAGGAAGAGAAGGG - Intronic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059757280 9:117305245-117305267 CTAGGGAAGGAGTCAGAGGAGGG - Intronic
1059812409 9:117870228-117870250 CTGGGGGAAGAGGAAGACAATGG + Intergenic
1060111786 9:120911670-120911692 CTGGTGGATAAGGAAAAGGAAGG - Intronic
1060190453 9:121589057-121589079 CTGGGGAGTGAGTAGGAGGCAGG - Intronic
1060221769 9:121767883-121767905 TTTGGGAATGAGGAAGAGGGAGG + Intronic
1060734053 9:126055124-126055146 CTGGGGAAGGTGGACGAGGGTGG + Intergenic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1060943865 9:127558462-127558484 CTGGGGCATGAGAAAAAGGAGGG + Intronic
1061077940 9:128353152-128353174 CTGGGGTATGTGGAAGCGGCTGG - Exonic
1061348573 9:130045504-130045526 GAGGAGAAAGAGGAAGAGGAAGG + Intergenic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061569453 9:131467815-131467837 GTGGGGCATGGGGACGAGGAGGG - Intronic
1061590261 9:131593528-131593550 CTCGGGAATGAGGGAGAAGGTGG - Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061891933 9:133626537-133626559 CTGGGTAATGGGCAAGAGGTTGG - Intergenic
1062028709 9:134352372-134352394 CTGGGGCATGAGGAAGCCGGAGG + Intronic
1062068500 9:134541633-134541655 CTGTGTCATGAGGATGAGGAGGG + Intergenic
1062201857 9:135307156-135307178 CTGGGGGAGGAAGAGGAGGAAGG - Intergenic
1062269776 9:135703113-135703135 CTGAGGGATGGGGGAGAGGATGG - Intronic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062525216 9:136975535-136975557 CTAGAAAATGGGGAAGAGGAGGG + Intergenic
1202780103 9_KI270717v1_random:25529-25551 TTGGGGGATGAGGAAAAGGCAGG + Intergenic
1203586869 Un_KI270747v1:10890-10912 CTGGGGGATGAGGAAAAGGCAGG + Intergenic
1203616465 Un_KI270749v1:71793-71815 CTGAGGGATGAGGAAAAGGCAGG - Intergenic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1185989429 X:4876462-4876484 CAGTGGAAAGAGGAAGAGGGTGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186225324 X:7393064-7393086 CTGGGAAAAGAGGAAGGGAAAGG - Intergenic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1187245478 X:17549763-17549785 CTGGGGGATGAGGGACCGGAGGG + Intronic
1187447668 X:19373130-19373152 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1187831708 X:23389075-23389097 CTGGGGAATGGGACAGAGAATGG - Intronic
1187877483 X:23816291-23816313 CTGAGGAGTTGGGAAGAGGAAGG - Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1188146674 X:26622263-26622285 TAAGGGAAGGAGGAAGAGGAGGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188639242 X:32478356-32478378 ATGGGGAATGAGGAAAAAGGTGG - Intronic
1189323122 X:40098002-40098024 GAGGGGGAGGAGGAAGAGGAGGG - Intronic
1189602195 X:42639191-42639213 GAGGAGAAAGAGGAAGAGGAAGG - Intergenic
1189645020 X:43118807-43118829 CTAAGGATTGAGGGAGAGGAAGG + Intergenic
1190309320 X:49105519-49105541 CTGAGGTGGGAGGAAGAGGATGG + Intergenic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1190339471 X:49285774-49285796 CAAGGGAATGAAGCAGAGGAGGG - Intronic
1190579891 X:51882026-51882048 CTGGGGAATAAGGCAGAGAGAGG + Intronic
1190665981 X:52696169-52696191 CTGGGGAACGTGGAAGAATAAGG - Intronic
1190673437 X:52762241-52762263 CTGGGGAACGTGGAAGAATAAGG + Intronic
1190676982 X:52791012-52791034 CTGGGGAACGTGGAAGAATAAGG + Intergenic
1191662494 X:63665809-63665831 CCTGGGGATGATGAAGAGGAGGG + Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192177487 X:68895035-68895057 CTCGGGGAGGAGGGAGAGGAGGG - Intergenic
1192288066 X:69759806-69759828 CTGGGGAATAAGGATAAGGAAGG + Intronic
1192312259 X:70026907-70026929 GTCGGGAATGAGGAATGGGAAGG - Intronic
1192362623 X:70449163-70449185 CTGGGGAATTGGGGAGGGGATGG + Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193164433 X:78264624-78264646 ATGGAGAATGAGGAAAAGCAGGG - Intergenic
1193645299 X:84060975-84060997 TTTGGGGAAGAGGAAGAGGAAGG + Intronic
1194448208 X:94012154-94012176 CTGGGCAACAAAGAAGAGGAAGG - Intergenic
1195324453 X:103747044-103747066 TTGGGGAATGGGGAAGAGAGTGG + Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195517526 X:105794390-105794412 GAGGGGGAGGAGGAAGAGGAGGG + Intergenic
1195557337 X:106241889-106241911 CTAGGGACTGAGGGAAAGGATGG - Intergenic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1195798117 X:108675668-108675690 CTGGCATATGAGAAAGAGGAAGG - Intronic
1195807712 X:108794737-108794759 CTGGGCATTGAAGAAGAGTAAGG + Intergenic
1195933758 X:110105955-110105977 CTATGAAATGAGGAAGATGATGG + Intronic
1195979577 X:110562898-110562920 GTGGGGAATGAAGGAGAGGAGGG + Intergenic
1196413115 X:115440905-115440927 CTTGGGAATGATGAAGACTAAGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197798381 X:130322418-130322440 CAGGGGAAAGAGGAAGGGGTTGG - Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198313160 X:135439027-135439049 CGTGGGAAAGAGGAAGGGGACGG + Intergenic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1198703169 X:139418628-139418650 CTGGGGACTGAGAGAGAGGTTGG + Intergenic
1198928938 X:141831341-141831363 CTTGGAAATGAGGATGGGGAAGG - Intergenic
1199381914 X:147181372-147181394 CTGGGTAAGGTGGAAGAGGGAGG + Intergenic
1199519339 X:148717803-148717825 CAGGTGAATGAGGAAGACCAAGG - Intronic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1200141244 X:153904135-153904157 GTGGGGCAGGAGGAAGAGGGTGG + Intronic